Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31899

Timm8b translocase of inner mitochondrial membrane 8 homolog b (yeast) ( MGI:1353424)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899
euxassay_005088_01 euxassay_005088_02 euxassay_005088_03 euxassay_005088_04 euxassay_005088_05
EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899
euxassay_005088_06 euxassay_005088_07 euxassay_005088_08 euxassay_005088_09 euxassay_005088_10
EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899
euxassay_005088_11 euxassay_005088_12 euxassay_005088_13 euxassay_005088_14 euxassay_005088_15
EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899
euxassay_005088_16 euxassay_005088_17 euxassay_005088_18 euxassay_005088_19 euxassay_005088_20
EMAGE:31899 EMAGE:31899 EMAGE:31899 EMAGE:31899
euxassay_005088_21 euxassay_005088_22 euxassay_005088_23 euxassay_005088_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 18
testis
moderate moderate
regionalmoderate expression: see section 04 05 06 17 18 19
axial musculature
moderate moderate
regionalmoderate expression: see section 03 04 05 17 18 19 20 21
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 18
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 09 10 15 16 17 18 19
vagus x ganglion
weak weak
regionalweak expression: see section 07 08 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 18 19
thymus primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 17 18 19 20 21
renal cortex
weak weak
regionalweak expression: see section 04 05 06 07 08 09 14 15 16 17 18
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 14 15 16
telencephalon ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 weak expression: see section 18 19
telencephalon marginal layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 15 19 20 21 22 23 24
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 14 15 16
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T7491
Entity Detected:Timm8b, translocase of inner mitochondrial membrane 8 homolog b (yeast) ( MGI:1353424)
Sequence:sense strand is shown

>T7491
CTCCGACAATGGCCGAGCTTGGTGAAGCGGACGAAGCGGAGTTACAACGCCTGGTGGCCGCCGAACAGCA
GAAGGCGCAATTCACTGCGCAGGTGCATCACTTCATGGAACTATGTTGGGATAAGTGTGTGGAGAAGCCA
GGAAGTCGGCTAGACTCCCGCACTGAAAACTGCCTCTCTAGCTGTGTGGATCGCTTCATTGACACTACTC
TTGCTATCACCGGTCGGTTTGCCCAGATCGTACAGAAAGGAGGGCAGTAGGCCATACCTTAGAATGACAG
AAGACCAAAAGACTTGTTACCAAGCAGATTGAATGGCCAGTGGTGAAAGACCTGCCAACCTGTCAGGTTA
GCGTCAGGCAGTTACAAAGTCTGTTGGTGTTAAAAAGTAACAGAGCAAATGTTCAAAAGTGAAATTTTAT
TTATGGGAATTCAGTAATTCCAACTTGTATCACACCAGTTAATAAATGTGAAGTCTCCAAAAAAAAAAAA
AAAA
Notes:The probe template was PCR amplified from IMAGE:4237232 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4237232 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005088 same experiment
 EMAGE:30616 same embryo
 EMAGE:31541 same embryo
 EMAGE:30594 same embryo
 EMAGE:30424 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS