Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31951

Fras1 ( MGI:2385368)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951
euxassay_010191_01 euxassay_010191_02 euxassay_010191_03 euxassay_010191_04 euxassay_010191_05
EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951
euxassay_010191_06 euxassay_010191_07 euxassay_010191_08 euxassay_010191_09 euxassay_010191_10
EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951
euxassay_010191_11 euxassay_010191_12 euxassay_010191_13 euxassay_010191_14 euxassay_010191_15
EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951
euxassay_010191_16 euxassay_010191_17 euxassay_010191_18 euxassay_010191_19 euxassay_010191_20
EMAGE:31951 EMAGE:31951 EMAGE:31951 EMAGE:31951
euxassay_010191_21 euxassay_010191_22 euxassay_010191_23 euxassay_010191_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
utricle
strong strong
regionalstrong expression: see section 05 06 07 08 18 19 20 21
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14
cochlea
strong strong
regionalstrong expression: see section 08 09 17 18 19
bladder
moderate moderate
regionalmoderate expression: see section 13 14
choroid invagination
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 15 16 17 18 19
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 20
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 20
peritoneal component
moderate moderate
regionalmoderate expression: see section 01 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 21 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 16 17 18 19
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 23 24
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23
mesothelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 23 24
pericardial cavity
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 23
right lung
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22 23 24
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10
kidney calyx
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20
urethra of male
moderate moderate
regionalmoderate expression: see section 13
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 13 16 17
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
external naris epithelium
moderate moderate
regionalmoderate expression: see section 12 13 17 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 10 11 18 19
naso-lacrimal duct
strong strong
regionalstrong expression: see section 04 05 06 08 09 moderate expression: see section 10 11
maxilla
moderate moderate
regionalmoderate expression: see section 06 07 08 09 12 13 16 17 18 19 20 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 17
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36392
Entity Detected:Fras1, ( MGI:2385368)
Sequence:sense strand is shown

>T36392
AAGCACACTTTTAGGTGGGTGTGGCCGGTGGTGTATCTGGGGAGTCGGGAACAGAAATACTGCGGTAATG
CATGAGCCGCATGTTGGCTTCCAGAGCAGGAGATCTGGAGGAAAGCCGATTTCACATTTCGAAGGTAATA
ATAGTGTGTTCGTTCAGGGCAGGAAAGGTTGGCTGAGCCCAGAAATTCCTGGCTGGTCAGGTGCTCCTTC
AGACCAGCTTGCATAATTCATAATTTCATAATTCAGGGCAGAAATTCTGAAATTGCTTCAAGAATCTGGA
ATCGCTACCCATCTCTTGCAGCAAAACTGATGAGCCACACCCTGGATCTCCAGGACAACAGACAGGGCTA
GAGCGCAGACAGGGAGCCAATCATCTGTAGAGCAGCTTCCCATTGGCCCATTACTGGTCACACCTCCCGC
TGTCCAGATGTTTGCACATTAGAGCTTTCAGTGGGCTCCACACCCACACACATACCTTCCTTTACACCTA
GTGGGACACATACATGTGAAGAGATGGCAGAGCCTGGCGCGGGAAGAGAGGCTGAATCTGAAGGCCTTTG
TGTACAGGTGGGCAGTGAAAGACAGGAGCCTGTGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 94174. Forward Primer - name:094174_F_cDNA_Fras1, sequence:AAGCACACTTTTAGGTGGGTGT; Reverse Primer - name:094174_N_SP6_cDNA_Fras1, sequence:CCACACAGGCTCCTGTCTTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010191 same experiment
 EMAGE:29729 same embryo
 EMAGE:29793 same embryo
 EMAGE:29819 same embryo
 EMAGE:31987 same embryo
 EMAGE:29820 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS