Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31955

Ninj1 ( MGI:1196617)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955
euxassay_009199_01 euxassay_009199_02 euxassay_009199_03 euxassay_009199_04 euxassay_009199_05
EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955
euxassay_009199_06 euxassay_009199_07 euxassay_009199_08 euxassay_009199_09 euxassay_009199_10
EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955
euxassay_009199_11 euxassay_009199_12 euxassay_009199_13 euxassay_009199_14 euxassay_009199_15
EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955
euxassay_009199_16 euxassay_009199_17 euxassay_009199_18 euxassay_009199_19 euxassay_009199_20
EMAGE:31955 EMAGE:31955 EMAGE:31955 EMAGE:31955
euxassay_009199_21 euxassay_009199_22 euxassay_009199_23 euxassay_009199_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15
organ system
moderate moderate
regionalmoderate expression: see section 02
visceral organ system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21
skeleton
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
integumental system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 14
sensory organ system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09
central nervous system
moderate moderate
regionalmoderate expression: see section 03 06
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12
peripheral nervous system
moderate moderate
regionalmoderate expression: see section 01 02 04 05 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cardiovascular system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
gland
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 not examined expression: see section 06 07 08
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2560
Entity Detected:Ninj1, ( MGI:1196617)
Sequence:sense strand is shown

>T2560
TGGCCTCGAGNCAGATTCGGACGAGGACATTATGCCACAAGAAGAGCGCTGCGGAGAGCATGCTGGACAT
CGCGCTGCTCATGGCCAACGCGTCGCAGCTGAAGGCCGTGGTGGAGCAGGGCAATGATTTCGCCTTCTTC
GTGCCCCTTGTGGTCCTCATCTCTATCTCCCTCGTGCTGCAGATAGGAGTGGGCGTGCTGCTCATCTTCC
TGGTCAAGTATGACCTCAACAACCCGGCCAAGCACGCCAAGCTGGACTTTCTTAACAACCTGGCCACGGG
ACTGGTTTTCATCATCGTCGTGGTCAACATCTTCATTACGGCCTTCGGGGTCCAGAAGCCTGTAATGGAC
GTGGCGCCCCGGCAGTAGAACGCCCAGAGACTTTAAGGGTACCGGACCTGCAGCCCAGCTGACCAGACCC
CTGCAACTGCTGTACCCCCAAGGTATCCCTCTCCTGTGTGCAGAGCCCAAGGTGGCCACCGCTGGACCAT
GGCCAGGGACGGACTTCCGTCCAACTGTGACCGCTGTGTGGGCGGCCA
Notes:The probe template was PCR amplified from IMAGE:1382604 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382604 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009199 same experiment
 EMAGE:31957 same embryo
 EMAGE:31956 same embryo
 EMAGE:29753 same embryo
 EMAGE:29755 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS