Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31956

Muc1 ( MGI:97231)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956
euxassay_009198_01 euxassay_009198_02 euxassay_009198_03 euxassay_009198_04 euxassay_009198_05
EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956
euxassay_009198_06 euxassay_009198_07 euxassay_009198_08 euxassay_009198_09 euxassay_009198_10
EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956
euxassay_009198_11 euxassay_009198_12 euxassay_009198_13 euxassay_009198_14 euxassay_009198_15
EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956
euxassay_009198_16 euxassay_009198_17 euxassay_009198_18 euxassay_009198_19 euxassay_009198_20
EMAGE:31956 EMAGE:31956 EMAGE:31956 EMAGE:31956
euxassay_009198_21 euxassay_009198_22 euxassay_009198_23 euxassay_009198_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
right lung
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
stomach pyloric region
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 moderate expression: see section 04
left lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09
pons mantle layer
moderate moderate
regionalmoderate expression: see section 04 07 08 12 13 16
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11
pancreas
strong strong
regionalstrong expression: see section 08 09 moderate expression: see section 07 13 14 15
lateral ventricle
weak weak
regionalweak expression: see section 20
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 16 17 18 19 20
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 07 19 21
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 02 03 04 09 10 11 12
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2557
Entity Detected:Muc1, ( MGI:97231)
Sequence:sense strand is shown

>T2557
ATTCGGACGAGGGGCCACCACTCCAGTTTACAGTAGCATGCCATTCTCTACTACCAAAGTGACGTCAGGC
TCAGCTATCATTCCAGACCACAATGGCTCCTCGGTGCTACCTACCAGTTCTGTGTTGGGCTCAGCTACCA
GTCTAGTCTATAATACCTCTGCAATAGCTACAACTCCAGTCAGCAATGGCACTCAGCCTTCAGTGCCAAG
TCAATACCCTGTTTCTCCTACCATGGCCACCACCTCCAGCCACAGCACTATTGCCAGCAGCTCTTACTAT
AGCACAGTACCATTTTCTACCTTCTCCAGTAACAGTTCACCCCAGTTGTCTGTTGGGGTCTCCTTCTTCT
TCTTGTCTTTTTACATTCAAAACCACCCATTTAATTCTTCTCTGGAAGACCCCAGCTCCAACTACTACCA
AGAACTGAAGAGGAACATTTCTGGATTGTTTCTGCAGATTTTTAACGGAGATTTTCTGGGGATCTCTAGC
ATCAAGTTCAGGTCAGGCTCCGTGGTGGTAGAAT
Notes:The probe template was PCR amplified from IMAGE:1382544 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382544 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009198 same experiment
 EMAGE:31957 same embryo
 EMAGE:31955 same embryo
 EMAGE:29753 same embryo
 EMAGE:29755 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS