Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31957

Hipk3 ( MGI:1314882)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957
euxassay_009195_01 euxassay_009195_02 euxassay_009195_03 euxassay_009195_04 euxassay_009195_05
EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957
euxassay_009195_06 euxassay_009195_07 euxassay_009195_08 euxassay_009195_09 euxassay_009195_10
EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957
euxassay_009195_11 euxassay_009195_12 euxassay_009195_13 euxassay_009195_14 euxassay_009195_15
EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957
euxassay_009195_16 euxassay_009195_17 euxassay_009195_18 euxassay_009195_19 euxassay_009195_20
EMAGE:31957 EMAGE:31957 EMAGE:31957 EMAGE:31957
euxassay_009195_21 euxassay_009195_22 euxassay_009195_23 euxassay_009195_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
foot
strong strong
regionalstrong expression: see section 03 04
heart atrium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 moderate expression: see section 04 14 15 16 17
leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 16 17 18 19 20 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
arm muscle
strong strong
regionalstrong expression: see section 01 02 17 18 19 20 21 22 23
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23 24
hand
strong strong
regionalstrong expression: see section 01 02 03 04
heart ventricle
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 moderate expression: see section 14 15
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
tongue muscle
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2561
Entity Detected:Hipk3, ( MGI:1314882)
Sequence:sense strand is shown

>T2561
TGGCCTCGAGCCAGATTCGGACGAGGCACTCCGAGAGTGTAAAGGTAGTCTAGATTGTGAAGCTTGCCAA
AGCACTTTGAATATTGATCGGATGTGTTCACTCAGCAGTCCTGATAGCACTCTGAGCACCAGCTCCTCAG
GGCAGTCCAGCCCGTCCCCTTGCAAGAGACCGAACAGCATGTCAGATGATGAACAAGAAAGCGGGTGTGA
GACTGTGGATGGCTCTCCAACATCAGACTCCTCGGGGCACGACAGTCCATTTGCAGAGAACAGTTTTGTG
GAGGATGCTCATCAGAACACAGAGCTGGGGACCTGTGCTGGCCCAGAAGCCAAGCCAGCTGTTGGCACTG
CTGTGGAGCCACCGGTGGGGAGAGAAAGTGGACTGAGTGTTGACGAGCACATGGCAAACACGGATTCTAC
ATGCCAGCCATTGAGAAAAGGCCAGCCTGCCCCCGGAAAGCTGCACCAGCCTCCTGCCCTGGGCGCTCGT
CAGCAGAAGCCCGCAGCAGCGTTCCCTCAGCAGCATTTGAAC
Notes:The probe template was PCR amplified from IMAGE:1382607 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382607 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009195 same experiment
 EMAGE:31956 same embryo
 EMAGE:31955 same embryo
 EMAGE:29753 same embryo
 EMAGE:29755 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS