Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31959

Gsta4 glutathione S-transferase, alpha 4 ( MGI:1309515)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31959 EMAGE:31959 EMAGE:31959 EMAGE:31959 EMAGE:31959
euxassay_004740_01 euxassay_004740_02 euxassay_004740_03 euxassay_004740_04 euxassay_004740_05
EMAGE:31959 EMAGE:31959 EMAGE:31959 EMAGE:31959 EMAGE:31959
euxassay_004740_06 euxassay_004740_07 euxassay_004740_08 euxassay_004740_09 euxassay_004740_10
EMAGE:31959 EMAGE:31959 EMAGE:31959 EMAGE:31959 EMAGE:31959
euxassay_004740_11 euxassay_004740_12 euxassay_004740_13 euxassay_004740_14 euxassay_004740_15
EMAGE:31959 EMAGE:31959 EMAGE:31959 EMAGE:31959 EMAGE:31959
euxassay_004740_16 euxassay_004740_17 euxassay_004740_18 euxassay_004740_19 euxassay_004740_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
tail skeleton
moderate moderate
regionalmoderate expression: see section 11 12
inner ear
strong strong
regionalstrong expression: see section 05 06 07 08 13 14 15 16 17 18 19
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11
metanephros
moderate moderate
regionalmoderate expression: see section 04 05 06 07 12 13
axial skeleton
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 10 11 12
testis
moderate moderate
regionalmoderate expression: see section 04 05 13 14 15
hyoid
strong strong
regionalstrong expression: see section 06 07 08 13 14 15
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10
bladder
moderate moderate
regionalmoderate expression: see section 11
choroid invagination
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 14 15 16
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 13
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 13
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 16 17
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 weak expression: see section 18 19
4th ventricle
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 weak expression: see section 18 19
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 12
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T693
Entity Detected:Gsta4, glutathione S-transferase, alpha 4 ( MGI:1309515)
Sequence:sense strand is shown

>T693
TCCTCGAGNCTGTTGGCCTACTGGAGAACCGCTTCTTTCCAGTGCCTGGAGACAACAATCCCACAAGAAT
AAGGAAGCTCTGAAGCAGGAGTCATGGCAGCCAAACCTAAGCTCTACTACTTTAATGGCAGGGGACGGAT
GGAGTCGATCCGCTGGCTGCTGGCTGCGGCTGGAGTGGAGTTTGAGGGAGAATTTCTTGAGACAAGGGAA
CAGTATGAGAAGATGCAAAAGGATGGACACCTGCTTTTCGGCCAAGTACCCTTGGTTGAAATCGATGGGA
TGATGCTGACACAGACCAGGGCCATCCTCAGCTACCTCGCTGCCAAGTACAACTTGTATGGGAAGGACCT
GAAGGAGAGAGTCAGGATTGACATGTATGCAGATGGCACCCAGGACCTGATGATGATGATTGCCGTGGCT
CCATTTAAAACCCCCAAGGAAAAAGAGGAGAGCTATGATTTGATACTGTCAAGAGCTAAAACCCGTTACT
TCCCAGTGTTTGAAAAGATTTTAAAAGACCACGGAGAGGCTTTTCTCGTTGGCAACCAGC
Notes:The probe template was PCR amplified from IMAGE:1889069 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1889069 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_004740 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS