Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31960

Frzb frizzled-related protein ( MGI:892032)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960
euxassay_000380_21 euxassay_000380_01 euxassay_000380_02 euxassay_000380_03 euxassay_000380_04
EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960
euxassay_000380_05 euxassay_000380_06 euxassay_000380_07 euxassay_000380_08 euxassay_000380_09
EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960
euxassay_000380_10 euxassay_000380_11 euxassay_000380_12 euxassay_000380_13 euxassay_000380_14
EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960
euxassay_000380_15 euxassay_000380_16 euxassay_000380_17 euxassay_000380_18 euxassay_000380_19
EMAGE:31960 EMAGE:31960 EMAGE:31960 EMAGE:31960
euxassay_000380_20 euxassay_000380_22 euxassay_000380_23 euxassay_000380_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
meckel's cartilage
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23
lower jaw molar
weak weak
regionalweak expression: see section 06 07 08 09 18 19 20 21
upper jaw molar
weak weak
regionalweak expression: see section 06 07 08 09 18 19 20 21
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 13 15 16 17
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 13 15 16 17
chondrocranium
weak weak
regionalweak expression: see section 02 03 04 05 22 23 24
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 16 17 18 19
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1420
Entity Detected:Frzb, frizzled-related protein ( MGI:892032)
Sequence:sense strand is shown

>T1420
CCCATCAAGCCCTGCAAGTCTGTGTGTGAGCGCGCCCGACAGGGCTGCGAGCCCATTCTCATCAAGTACC
GCCACTCGTGGCCGGAAAGCTTGGCCTGCGACGAGCTGCCGGTGTACGACCGCGGCGTGTGCATCTCTCC
TGAGGCCATCGTCACCGCGGACGGAGCGGATTTTCCTATGGATTCAAGTACTGGACACTGCAGAGGGGCA
AGCAGCGAACGTTGCAAATGTAAGCCTGTCAGAGCTACACAGAAGACCTATTTCCGGAACAATTACAACT
ATGTCATCCGGGCTAAAGTTAAAGAGGTAAAGATGAAATGTCATGATGTGACCGCCGTTGTGGAAGTGAA
GGAAATTCTAAAGGCATCACTGGTAAACATTC
Notes:The probe template was PCR amplified from IMAGE:2394907 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2394907 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000380 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS