Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31970

Fndc1 ( MGI:1915905)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970
euxassay_010189_01 euxassay_010189_02 euxassay_010189_03 euxassay_010189_04 euxassay_010189_05
EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970
euxassay_010189_06 euxassay_010189_07 euxassay_010189_08 euxassay_010189_09 euxassay_010189_10
EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970
euxassay_010189_11 euxassay_010189_12 euxassay_010189_13 euxassay_010189_14 euxassay_010189_15
EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970
euxassay_010189_16 euxassay_010189_17 euxassay_010189_18 euxassay_010189_19 euxassay_010189_20
EMAGE:31970 EMAGE:31970 EMAGE:31970 EMAGE:31970
euxassay_010189_21 euxassay_010189_22 euxassay_010189_23 euxassay_010189_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 07 14 15 16 17
oral epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
cornea epithelium
strong strong
regionalstrong expression: see section 04 05 06 23 24
upper lip
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19
dermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
sublingual gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 12
conjunctival sac
strong strong
regionalstrong expression: see section 01 02 03 04
lower lip
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36390
Entity Detected:Fndc1, ( MGI:1915905)
Sequence:sense strand is shown

>T36390
AAAGAGTGATCTGCCTCCTCAGCACGCTCCCCGGAACATTACTGTGGTCGCCATGGAAGGCTGCCACTCC
TTTGTCATTGTGGACTGGAACAAAGCCATCCCTGGAGATGTGGTAACAGGATACCTGGTCTACAGCGCCT
CTTATGAGGACTTCATCCGGAATAAATGGTCAACTCAGACCTCGTCAGTGACCCATCTGCCCATTGAGAA
CTTGAAGCCAAACACAAGGTATTACTTCAAAGTTCAAGCCAAAAACCCTCATGGCTATGGGCCTGTCAGT
CCTTCAGTCTCATTTGTTACAGAATCAGACAATCCTCTGCTGGTTGTGAGGCCACCAGGTGGTGAGCCCA
TCTGGATCCCATTCGCTTTCAAGCATGATCCTGGCTACACTGATTGCCATGGTCGGCAGTATGTGAAACG
AACATGGTACAAAAAGTTTGTGGGAGTCGTTCTTTGTAATTCTCTAAGGTATAAGATCTACCTCAGTGAC
AATCTCAAAGACACATTCTACAGCATTGGAGACAGCTGGGGAAGAGGTGAAGACCACTGTCAGTTTGTGG
ATTCGCACCTGGATGGAAGAACAGGGCCTCAATCTTATATAGAAGCCCTCCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85141. Forward Primer - name:085141_F_cDNA_Fndc1, sequence:AAAGAGTGATCTGCCTCCTCAG; Reverse Primer - name:085141_N_SP6_cDNA_Fndc1, sequence:GGGGAGGGCTTCTATATAAGAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010189 same experiment
 EMAGE:30692 same embryo
 EMAGE:30619 same embryo
 EMAGE:31950 same embryo
 EMAGE:30694 same embryo
 EMAGE:30660 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS