Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31991

Csdc2 cold shock domain containing C2, RNA binding ( MGI:2146027)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991
euxassay_002780_01 euxassay_002780_02 euxassay_002780_03 euxassay_002780_04 euxassay_002780_05
EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991
euxassay_002780_06 euxassay_002780_07 euxassay_002780_08 euxassay_002780_09 euxassay_002780_10
EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991
euxassay_002780_11 euxassay_002780_12 euxassay_002780_13 euxassay_002780_14 euxassay_002780_15
EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991
euxassay_002780_16 euxassay_002780_17 euxassay_002780_18 euxassay_002780_19 euxassay_002780_20
EMAGE:31991 EMAGE:31991 EMAGE:31991 EMAGE:31991
euxassay_002780_21 euxassay_002780_22 euxassay_002780_23 euxassay_002780_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 03 moderate expression: see section 20 21
not examined not examined
regionalnot examined expression: see section 01 02 03 23 24
neural retina
strong strong
regionalstrong expression: see section 01 02 03 23 24
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 moderate expression: see section 05 06 07 08 17 18 19 20 21 22
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 16 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2174
Entity Detected:Csdc2, cold shock domain containing C2, RNA binding ( MGI:2146027)
Sequence:sense strand is shown

>T2174
AATTCGGATCCACGTGCCCTGAGAAATGGCTGCAAGCAGGAGGGAACTTTAGCACTCCTGTTATGTAGGC
CAGTCCTCTCTCCTCAGCTGTCAGATGATCTTTGAACCCCACAGAGCTGAGGAAGCCAAGCTCACTCACT
CCCTGAGGTGAGGCGGGGATAGGGTTTCCTTCCAGCTTGCTCTTCTACCCGGGATGCTCAAACCTCACGA
ATGCTCTGGCCCATTGCTGGCCATGACAGCAGCTGAGGATGCAGCAATGGACTGACATGTCACCTCAGGC
AAGGCCAGGTCCAGGCACCCAAAGGATCGGTCCTCAGCCAGGGAGACCACTGGCTTTGCCCCTCCCACCC
CCCATGAGATCCTCTTCCCAGAGCTATGCAATGGCTCTCATAAGCCCCTGACAGGTCAGCAGCTGAGGTG
GCTCTTATCTCTCTTGTCCCCAAGTGTGACTGTCCCTCTTCCCTGGAGTCCCTTTGGAGCTGTGTCCCTT
CTAGAGAGCCAGTTACTTAACCAGAGGATAAGTGAGGTCACA
Notes:The probe template was PCR amplified from IMAGE:889232 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:889232 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002780 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS