Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31993

Col15a1 collagen, type XV, alpha 1 ( MGI:88449)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31993 EMAGE:31993 EMAGE:31993 EMAGE:31993 EMAGE:31993
euxassay_002783_01 euxassay_002783_02 euxassay_002783_03 euxassay_002783_04 euxassay_002783_05
EMAGE:31993 EMAGE:31993 EMAGE:31993 EMAGE:31993 EMAGE:31993
euxassay_002783_06 euxassay_002783_07 euxassay_002783_08 euxassay_002783_09 euxassay_002783_10
EMAGE:31993 EMAGE:31993 EMAGE:31993 EMAGE:31993 EMAGE:31993
euxassay_002783_11 euxassay_002783_12 euxassay_002783_13 euxassay_002783_14 euxassay_002783_15
EMAGE:31993 EMAGE:31993 EMAGE:31993 EMAGE:31993 EMAGE:31993
euxassay_002783_16 euxassay_002783_17 euxassay_002783_18 euxassay_002783_19 euxassay_002783_20
EMAGE:31993 EMAGE:31993
euxassay_002783_21 euxassay_002783_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 22
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 22
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 moderate expression: see section 07 08 09 10
metanephros
strong strong
regionalstrong expression: see section 09 10 11 19 20
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 22
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09 10 19 20 21 weak expression: see section 11
male reproductive system
moderate moderate
regionalmoderate expression: see section 16 17
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
nose
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 17 18 19
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 22
axial musculature
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 21 22
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pericardium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
bladder
moderate moderate
regionalmoderate expression: see section 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 18 19 20 moderate expression: see section 07 08 09 10 17
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 22
hindgut
moderate moderate
regionalmoderate expression: see section 14 15 16 17
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 05 06 07 08 09 10 11 12 16 17 18 19
nasal septum
moderate moderate
regionalmoderate expression: see section 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T396
Entity Detected:Col15a1, collagen, type XV, alpha 1 ( MGI:88449)
Sequence:sense strand is shown

>T396
CTATGAGAGGCCTGTTCTGCACCTGGTTGCTCTGAACACACCGGTGGCTGGGGACATCCGAGCTGATTTC
CAGTGCTTCCAGCAGGCCAGGGCTGCAGGCCTCCTGTCCACTTTCCGAGCCTTTCTGTCTTCACACCTGC
AGGATCTCTCCACAGTCGTGCGGAAGGCAGAGAGGTTCGGCCTTCCAATTGTGAATCTCAAGGGCCAAGT
GCTTTTTAACAATTGGGACTCGATATTTTCTGGTGATGGAGGTCAATTCAATACACACATTCCAATCTAC
TCCTTTGACGGTCGGGATGTGATGACTGATCCTTCCTGGCCCCAGAAGGTGGTCTGGCACGGCTCCAACC
CCCATGGTGTCCGTCTTGTGGACAAGTACTGTGAAGCCTGGCGAACCACGGACATGGCAGTAACCGGATT
TGCCTCCCCACTGAGCACAGGGAAGATTCTGGACCAGAAAGCTTACAGCTGTGCTAACAGGC
Notes:The probe template was PCR amplified from IMAGE:3156838 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3156838 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002783 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS