Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31994

Clmn calmin ( MGI:2136957)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31994 EMAGE:31994 EMAGE:31994 EMAGE:31994 EMAGE:31994
euxassay_002782_01 euxassay_002782_02 euxassay_002782_03 euxassay_002782_04 euxassay_002782_05
EMAGE:31994 EMAGE:31994 EMAGE:31994 EMAGE:31994 EMAGE:31994
euxassay_002782_06 euxassay_002782_07 euxassay_002782_08 euxassay_002782_09 euxassay_002782_10
EMAGE:31994 EMAGE:31994 EMAGE:31994 EMAGE:31994 EMAGE:31994
euxassay_002782_11 euxassay_002782_12 euxassay_002782_13 euxassay_002782_14 euxassay_002782_15
EMAGE:31994 EMAGE:31994 EMAGE:31994 EMAGE:31994 EMAGE:31994
euxassay_002782_16 euxassay_002782_17 euxassay_002782_18 euxassay_002782_19 euxassay_002782_20
EMAGE:31994 EMAGE:31994 EMAGE:31994
euxassay_002782_21 euxassay_002782_22 euxassay_002782_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
stomach
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11
kidney calyx
strong strong
regionalstrong expression: see section 09 11 21
rectum
moderate moderate
regionalmoderate expression: see section 15
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 04
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
bladder
moderate moderate
regionalmoderate expression: see section 14 15
pancreas
strong strong
regionalstrong expression: see section 10 11 12 13 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 20 weak expression: see section 10 18 19
kidney pelvis
strong strong
regionalstrong expression: see section 10 20
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 15 16 17 18 19
hindgut
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17
naris
strong strong
regionalstrong expression: see section 13 14 15 16 17
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 22 23
pectoral girdle and thoracic body wall musculature
moderate moderate
regionalmoderate expression: see section 05 06 07 08 12 13 14 15 16 17 21 22 weak expression: see section 04 09 10 11 18 19 20
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T366
Entity Detected:Clmn, calmin ( MGI:2136957)
Sequence:sense strand is shown

>T366
CTAATGGCTCTGTTAGAAGTCCTCTCTGGGCGAAATCTGCTGCATGAATACAAATCCTCATCACATCGTA
TTTTTCGGTTGAACAACATAGCGAAAGCACTCAAGTTTCTGGAAGATAGCAATGTCAAGCTGGTTAGCAT
CGATGCAGCGGAAATAGCGGACGGCAACCCCTCGCTGGTTCTCGGGCTGATATGGAACATCATTCTCTTC
TTCCAGATAAAGGAGCTCACGGGCAACCTCAGCAGGAGTTCTCCATCTTCCAGCTTGTCACCGGGCTCTG
GGGGCACCGACTCCGACTCTTCCTACCCACCCACCCCCACCACCGAGAGGAGTGTGGCAGTGGCAGTGAA
AGACCAGAGGAAGGCCATCAAGACCCTGCTGTCATGGGTGCAGAGGAAAACCAGGAAGTATGGTGTGGCA
GTCCAAGACTTTGCAGGCAGCTGGAGGAGTGGCCTGGCTTTCCTGGCTGTCATCAAAGCTATTGA
Notes:The probe template was PCR amplified from IMAGE:3155880 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3155880 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002782 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS