Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32013

Dnmt3b DNA methyltransferase 3B ( MGI:1261819)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013
euxassay_002794_01 euxassay_002794_02 euxassay_002794_03 euxassay_002794_04 euxassay_002794_05
EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013
euxassay_002794_06 euxassay_002794_07 euxassay_002794_08 euxassay_002794_09 euxassay_002794_10
EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013
euxassay_002794_11 euxassay_002794_12 euxassay_002794_13 euxassay_002794_14 euxassay_002794_15
EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013
euxassay_002794_16 euxassay_002794_17 euxassay_002794_18 euxassay_002794_19 euxassay_002794_20
EMAGE:32013 EMAGE:32013 EMAGE:32013 EMAGE:32013
euxassay_002794_21 euxassay_002794_22 euxassay_002794_23 euxassay_002794_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 19 20 moderate expression: see section 09 10 18 21
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 16 17
renal cortex
moderate moderate
regionalmoderate expression: see section 08 19 20 weak expression: see section 09 10 11 12 21 22 23
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 moderate expression: see section 07 08 17 18 21 24 weak expression: see section 09 10 11 15 19 20 22 23
midbrain ventricular layer
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 11 12 13 15 weak expression: see section 14 18
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 20 21 22 23 24 weak expression: see section 07 08 18 19
axial musculature
strong strong
regionalstrong expression: see section 23 24 moderate expression: see section 06 07 08 09 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2181
Entity Detected:Dnmt3b, DNA methyltransferase 3B ( MGI:1261819)
Sequence:sense strand is shown

>T2181
TGGCCTCGAGCCAGATTCGGCACGAGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCT
ATCAGTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTAACACAAGCTGCTGCAG
ATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTGGGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAA
CCCTGGAGCTGCTATATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATTGGAACA
TGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAATTTCAGGAGCCACCCAAGTTGTACCC
AGCAATTCCTGCAGCCAAAAGGAGGCCCATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTAC
TTGGTGCTCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGTGCAGAGTCCATCG
CTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATATGTCAATGACGTCCGGAAAATCACCAAGA
Notes:The probe template was PCR amplified from IMAGE:891000 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:891000 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002794 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS