Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32019

6530418L21Rik RIKEN cDNA 6530418L21 gene ( MGI:1923497)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019
euxassay_002765_01 euxassay_002765_02 euxassay_002765_03 euxassay_002765_04 euxassay_002765_05
EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019
euxassay_002765_06 euxassay_002765_07 euxassay_002765_08 euxassay_002765_09 euxassay_002765_10
EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019
euxassay_002765_11 euxassay_002765_12 euxassay_002765_13 euxassay_002765_14 euxassay_002765_15
EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019
euxassay_002765_16 euxassay_002765_17 euxassay_002765_18 euxassay_002765_19 euxassay_002765_20
EMAGE:32019 EMAGE:32019 EMAGE:32019 EMAGE:32019
euxassay_002765_21 euxassay_002765_22 euxassay_002765_23 euxassay_002765_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 14 15 16 17 18
ventral grey horn
moderate moderate
single cellmoderate expression: see section 12 13 14 15 16 17
pons mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 14 15 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2140
Entity Detected:6530418L21Rik, RIKEN cDNA 6530418L21 gene ( MGI:1923497)
Sequence:sense strand is shown

>T2140
TTTCCTGCAGACCTGGTGGGTAACTGGCTANATNTACCAGAACTGGAAAAGGGCGGGGAAAAGGGTGAGA
CTGGGGGATCCATTGAACCCAAAGGAGAAAAAGGCCAGTCCAGAGAGCTGGGTCGTAAGTTTGCCCTAAC
CGCAAACATTTTTAGGAAGTTCTTGCGTAGCGTGCGGCCCGACAGAGACCGGCTGCTCAAGGAGAAGCCT
GGCTGGATGACTCCCATGGTCTCTGAGTCACGAGCAGGACGCTCGAAGAAAGTCAAGAAGAGGAGCCTTT
CTAAGGGCTCAGGACGGTTCCCTTTCTCAAGCACAGGAGAGCCCAGACATATTGAAACCCCCGCCACAAG
CAGCCCCAAGGCCTTAGAACCCTCCTGTAGGGGCTTTGACATTAACACAGCTGTTTGGGTCTGAANAAAA
AAAAAANNAAA
Notes:The probe template was PCR amplified from IMAGE:874260 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:874260 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002765 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS