Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32023

Cyp2d10 cytochrome P450, family 2, subfamily d, polypeptide 10 ( MGI:88602)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32023 EMAGE:32023 EMAGE:32023 EMAGE:32023 EMAGE:32023
euxassay_002769_01 euxassay_002769_02 euxassay_002769_03 euxassay_002769_04 euxassay_002769_05
EMAGE:32023 EMAGE:32023 EMAGE:32023 EMAGE:32023 EMAGE:32023
euxassay_002769_06 euxassay_002769_07 euxassay_002769_08 euxassay_002769_09 euxassay_002769_10
EMAGE:32023 EMAGE:32023 EMAGE:32023 EMAGE:32023 EMAGE:32023
euxassay_002769_11 euxassay_002769_12 euxassay_002769_13 euxassay_002769_14 euxassay_002769_15
EMAGE:32023 EMAGE:32023 EMAGE:32023 EMAGE:32023 EMAGE:32023
euxassay_002769_16 euxassay_002769_17 euxassay_002769_18 euxassay_002769_19 euxassay_002769_20
EMAGE:32023 EMAGE:32023 EMAGE:32023
euxassay_002769_21 euxassay_002769_22 euxassay_002769_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T908
Entity Detected:Cyp2d10, cytochrome P450, family 2, subfamily d, polypeptide 10 ( MGI:88602)
Sequence:sense strand is shown

>T908
TCCTCNAGNCTGTTGGCCTACTGGAAATCTGATTCTAGGTGTTACATTGAGTGTTGTTCATTGGTCTCTG
GAAAGCCTGGGCAGAAGTGGGGTAGCCATGGAGCTGCTGACTGGGGCTGGCCTGTGGTCTGTGGCCATAT
TCACCGTTATCTTCATATTACTGGTGGACCTGATGCACCGGCACCAGCGCTGGACTTCTCGCTACCCACC
GGGCCCTGTGCCATGGCCTGTGCTGGGTAACCTGCTGCAGGTGGACCTGGATAACATGCCATACAGCTTG
TACAAGCTTCAAAACCGCTATGGTGACGTGTTCAGCCTGCAGATGGGCTGGAAGCCTATGGTTGTGATCA
ATGGACTGAAGGCAATGAAGGAAGTGCTGTTGACCTGTGGAGAGGACACTGCTGACCGCCCTCAAGTGCC
CATCTTTGAGTACCTGGGTGTGAAGCCTGGATCCCAAGGTGTGGTCCTTGCACCCTACGGGCCCGAGTGG
CGAGAGCAGAGGCGATTCTCTGTGTCTACCCTGCGCAACTTTGGCCTGGGCAAGAAA
Notes:The probe template was PCR amplified from IMAGE:1924650 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1924650 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002769 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS