Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32024

Casp8ap2 caspase 8 associated protein 2 ( MGI:1349399)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024
euxassay_002768_01 euxassay_002768_02 euxassay_002768_03 euxassay_002768_04 euxassay_002768_05
EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024
euxassay_002768_06 euxassay_002768_07 euxassay_002768_08 euxassay_002768_09 euxassay_002768_10
EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024
euxassay_002768_11 euxassay_002768_12 euxassay_002768_13 euxassay_002768_14 euxassay_002768_15
EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024
euxassay_002768_16 euxassay_002768_17 euxassay_002768_18 euxassay_002768_19 euxassay_002768_20
EMAGE:32024 EMAGE:32024 EMAGE:32024 EMAGE:32024
euxassay_002768_21 euxassay_002768_22 euxassay_002768_23 euxassay_002768_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 17 18 19 20 21
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T822
Entity Detected:Casp8ap2, caspase 8 associated protein 2 ( MGI:1349399)
Sequence:sense strand is shown

>T822
TCCTCGAGNCTGTTGGCCTACTGGGTATACAGCTCAGAAAAGAGAAGCCCTGCATCTCTTCCATACTCTT
AGAAGATCTTGCGGTCTCTTTAACAGTACCGTCACCTCTGAAATCAGATGGCCATTTGAGTTTCTTAAAG
CCAGAAGTTTTGTCAACTTCAACTCCTGAAGAAGTTATTAGTGCACATTTTAGTGAGGATGCTTTGCTTG
AGGAAGAGGATGCATCTGAACAGGACATTCATCTAGCTCTGGAGTCTGATAACTCAAGCAGTAAGTCAAG
CTGTTCATCATGGACAAGCCGGTCTGTTGCTTCAGGCTTTCAGTACCACCCTAATCTTCCCATGCATGCT
GTCATAATGGAAAAGTCCAATGATCATTTCATTGTGAAAATACGGCGTGCAACACCATCTACCTCCCCTG
GCCTTAAACATGGTGTGGTAGCTGAGGAGTCATTGACATCTTTGCCTAGAACTGGAAAAGAAGCTGGTGT
AGCAACAGAGAAAGAACCTAACCTGTTTCAGAGTACAGTTTTAAAACCTGTC
Notes:The probe template was PCR amplified from IMAGE:1922175 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1922175 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002768 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS