Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32043

Olfml3 olfactomedin-like 3 ( MGI:1914877)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32043 EMAGE:32043 EMAGE:32043 EMAGE:32043 EMAGE:32043
euxassay_000583_01 euxassay_000583_02 euxassay_000583_03 euxassay_000583_04 euxassay_000583_05
EMAGE:32043 EMAGE:32043 EMAGE:32043 EMAGE:32043 EMAGE:32043
euxassay_000583_06 euxassay_000583_07 euxassay_000583_08 euxassay_000583_09 euxassay_000583_10
EMAGE:32043 EMAGE:32043 EMAGE:32043 EMAGE:32043 EMAGE:32043
euxassay_000583_11 euxassay_000583_12 euxassay_000583_13 euxassay_000583_14 euxassay_000583_15
EMAGE:32043 EMAGE:32043 EMAGE:32043 EMAGE:32043 EMAGE:32043
euxassay_000583_16 euxassay_000583_17 euxassay_000583_18 euxassay_000583_19 euxassay_000583_20
EMAGE:32043 EMAGE:32043 EMAGE:32043
euxassay_000583_21 euxassay_000583_22 euxassay_000583_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
foregut-midgut junction
weak weak
homogeneousweak expression: see section 12 13 14 15 16 17
stomach
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09
kidney calyx
weak weak
regionalweak expression: see section 08 09 19 20 21
chondrocranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 weak expression: see section 06 07 21 22 23
skeleton
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midgut
weak weak
homogeneousweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 18 19 20 21 22 23 weak expression: see section 08 09 10 11 15 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18 19 20 21 weak expression: see section 08
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 07 18 19 20 21 22 23 weak expression: see section 08 09 17
kidney pelvis
weak weak
regionalweak expression: see section 10 11 18
hindgut
weak weak
homogeneousweak expression: see section 12 13 14 15 16 17
lower jaw incisor
weak weak
regionalweak expression: see section 10
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 09 10 11 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T817
Entity Detected:Olfml3, olfactomedin-like 3 ( MGI:1914877)
Sequence:sense strand is shown

>T817
TCCTCAGNCTGTTGGCCTACTGGGGAGAGCTAACGGGCTGGAGGGAAAGAGGCCGAATGCACACACTCCT
CTGGCCCCACTTAAGGCTGCCATGGGGCCCAGTGCTCCTCTGCTGCTCCTCTTCTTTTTGTCATGGACGG
GACCCCTTCAGGGACAGCAGCACCACCTTGTGGAGTACATGGAACGCTGACTAGCTGCCTTAGAGGAACG
GCTGGCCCAATGCCAGGATCAGAGTAGTCGGCATGCTGCCGAGCTTCGGGACTTCAAAAACAAGATGTTG
CCTCTCCTGGAGGTGGCAGAGAAGGAGCGGGAGACCCTCAGAACTGAAGCAGACTCCATCTCAGGAAGAG
TGGACCGTCTTGAAAGGGAGGTAGACTATCTGGAGACACAGAACCCAGCTTTGCCCTGTGTAGAGCTGGA
TGAGAAGGTGACTGGAGGTCCTGGAGCCAAAGGCAAGGGCCGAAGAAATGAGAAATACGATATGGTGACG
GACTGTAGCTACACAGTCGCTCAGGTGAGGTCAATGAAGATCCTGAAGCGGTTTGGTGGTTCAGTT
Notes:The probe template was PCR amplified from IMAGE:1922057 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1922057 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000583 same experiment
 EMAGE:30207 same embryo
 EMAGE:32041 same embryo
 EMAGE:30585 same embryo
 EMAGE:30078 same embryo
 EMAGE:30579 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS