Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32045

P4ha1 ( MGI:97463)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32045 EMAGE:32045 EMAGE:32045 EMAGE:32045 EMAGE:32045
euxassay_000584_01 euxassay_000584_02 euxassay_000584_03 euxassay_000584_04 euxassay_000584_05
EMAGE:32045 EMAGE:32045 EMAGE:32045 EMAGE:32045 EMAGE:32045
euxassay_000584_06 euxassay_000584_07 euxassay_000584_08 euxassay_000584_09 euxassay_000584_10
EMAGE:32045 EMAGE:32045 EMAGE:32045 EMAGE:32045 EMAGE:32045
euxassay_000584_11 euxassay_000584_12 euxassay_000584_13 euxassay_000584_14 euxassay_000584_15
EMAGE:32045 EMAGE:32045 EMAGE:32045 EMAGE:32045 EMAGE:32045
euxassay_000584_16 euxassay_000584_17 euxassay_000584_18 euxassay_000584_19 euxassay_000584_20
EMAGE:32045 EMAGE:32045 EMAGE:32045
euxassay_000584_21 euxassay_000584_22 euxassay_000584_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 22 23
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19 20 21 22
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19 20 21 22
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 12 13 14 16 17
upper jaw incisor
weak weak
regionalweak expression: see section 10 11 12 13 16 17
chondrocranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 21 22 23
nasal capsule
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
axial skeleton
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T794
Entity Detected:P4ha1, ( MGI:97463)
Sequence:sense strand is shown

>T794
TCCTCGAGNCTGTTGGCCTACTATGAGCGATGTGTCTGCTGGAGGAGCTACTGTTTTTCCTGAAGTGGGA
GCCAGTGTTTGGCCCAAAAAAGGCACTGCTGTCTTCTGGTATAATCTGTTTGCCAGTGGGGAAGGAGATT
ACAGTACACGGCATGCAGCCTGTCCCGTGCTAGTTGGAAACAAATGGGTATCCAACAAATGGCTCCATGA
ACGTGGACAAGAATTTCGAAGGCCGTGCACCCTGTCAGAATTGGAATGACAACCAGGCTTCCCTTGGCTC
CTGTTGTCCTCTAACGCACCAGGCACGATGGCTGATTATAACTCCGACGTTTACAGCTGACTAACACTCC
ATGATTAATTGGGCCATGAGCCTCAGCCCCATGTCTCACCTGTGGACAATCACTTATTTTGTGGATTTCT
TTAATTAATACTCAATCACCACATGATGTAAAACTTATGGTTCAGTTTTCACAGGATACAAGGCATTGAA
AATGAGGAACCTAATTTTGTTGTTTAAAAGAGCTTTTTGGT
Notes:The probe template was PCR amplified from IMAGE:1920914 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1920914 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000584 same experiment
 EMAGE:32020 same embryo
 EMAGE:30416 same embryo
 EMAGE:32078 same embryo
 EMAGE:30583 same embryo
 EMAGE:30666 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS