Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32071

Myh4 ( MGI:1339713)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071
euxassay_010389_01 euxassay_010389_02 euxassay_010389_03 euxassay_010389_04 euxassay_010389_05
EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071
euxassay_010389_06 euxassay_010389_07 euxassay_010389_08 euxassay_010389_09 euxassay_010389_10
EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071
euxassay_010389_11 euxassay_010389_12 euxassay_010389_13 euxassay_010389_14 euxassay_010389_15
EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071
euxassay_010389_16 euxassay_010389_17 euxassay_010389_18 euxassay_010389_19 euxassay_010389_20
EMAGE:32071 EMAGE:32071 EMAGE:32071 EMAGE:32071
euxassay_010389_21 euxassay_010389_22 euxassay_010389_23 euxassay_010389_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
tongue muscle
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 21 22 23 24
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
foot
strong strong
regionalstrong expression: see section 06 07 17 18 19
eye skeletal muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 15 16 17 18 19 20 21 22 23
heart atrium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
leg muscle
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 19 20 21 22 23 24
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23 24
hand
strong strong
regionalstrong expression: see section 01 02 03 17 18 19 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30524
Entity Detected:Myh4, ( MGI:1339713)
Sequence:sense strand is shown

>T30524
TCCCAACATCCAGGGAGAGATGGAAGACATCGTCCAGGAGGCCCGCAACGCAGAAGAGAAGGCCAAGAAA
GCCATCACTGATGCCGCCATGATGGCGGAGGAGCTGAAGAAGGAGCAGGACACCAGCGCCCACCTGGAGC
GGATGAAGAAGAACATGGAGCAGACCGTGAAGGACCTGCAGCACCGTCTGGACGAGGCTGAGCAGCTGGC
GCTGAAGGGCGGCAAGAAGCAGATCCAGAAACTGGAGGCTAGGGTGAGGGAGCTTGAAAACGAGGTGGAA
AATGAACAGAAGCGCAACATCGAAGCCGTCAAGGGTCTTCGTAAGCACGAGCGCAGAGTGAAGGAACTCA
CCTACCAGACCGAGGAGGACCGCAAGAACGTGCTGAGGCTGCAGGACTTGGTGGACAAACTACAGACTAA
AGTGAAAGCCTACAAGAGACAGGCTGAGGAGGCTGAGGAACAATCCAATGTCAACCTGGCCAAGTTCCGT
AAGATCCAGCACGAGCTGGAGGAAGCCGAGGAGCGGGCTGACATCGCGGAGTCCCAGGTCAACAAGCTGC
GGGTGAAGAGCCGAGAGGTTCACACTAAAGTCATAAGCGAAGAATAATCCATCTTTCTGTTGAGAGGTGA
CAGGAGAAATCACAAAATGTGAGCGTTCTTTGTCACTGTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:1247485), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59317. Forward Primer - name:059317_F_IRAV110_d08_Myh4, sequence:TCCCAACATCCAGGGAGA; Reverse Primer - name:059317_R_SP6_IRAV110_d08_Myh4, sequence:AGGACAGTGACAAAGAACG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010389 same experiment
 EMAGE:30669 same embryo
 EMAGE:30691 same embryo
 EMAGE:32063 same embryo
 EMAGE:30552 same embryo
 EMAGE:30688 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS