Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32073

Grin3a ( MGI:1933206)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073
euxassay_015836_01 euxassay_015836_02 euxassay_015836_03 euxassay_015836_04 euxassay_015836_05
EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073
euxassay_015836_06 euxassay_015836_07 euxassay_015836_08 euxassay_015836_09 euxassay_015836_10
EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073
euxassay_015836_11 euxassay_015836_12 euxassay_015836_13 euxassay_015836_14 euxassay_015836_15
EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073
euxassay_015836_16 euxassay_015836_17 euxassay_015836_18 euxassay_015836_19 euxassay_015836_20
EMAGE:32073 EMAGE:32073 EMAGE:32073 EMAGE:32073
euxassay_015836_21 euxassay_015836_22 euxassay_015836_23 euxassay_015836_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 03 04 moderate expression: see section 21
ventral grey horn
strong strong
regionalstrong expression: see section 10 11 12 14 15
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 02 03 19 moderate expression: see section 20
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16 17
palatal shelf
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 12
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 03 04 19 moderate expression: see section 20 21
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 11 12 13
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 18 19 moderate expression: see section 20 21
pons mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 17 18 19 20
dorsal grey horn
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 06 07
upper jaw molar
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 06 07
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 18 19 moderate expression: see section 20 21
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 moderate expression: see section 06 07 08 11 18 19 20 23 24 weak expression: see section 21 22
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 14 15 16 17 18 19
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40443
Entity Detected:Grin3a, ( MGI:1933206)
Sequence:sense strand is shown

>T40443
CCAGCTGGAAAACATTAGGAACAGCACACCCACAATGGTGATGTTTGGCTGTGACATGGGGAGCATCCGG
CAGATATTTGAAATGTCCACACAGTTTGGGCTATCACCTCCTGATCTTCACTGGGTTTTAGGAGACTCAC
AGAATGTGGAGGAGCTGAGGACAGAAGGCCTGCCCTTAGGGCTCATTGCTCATGGAAAAACCACACAGTC
TGTCTTTGAGTACTATGTTCAGGATGCCATGGAGTTGGTTGCAAGAGCTGTAGCCACAGCCACCATGATC
CAGCCAGAACTTGCTCTCCTTCCCAGCACAATGAACTGCATGGATGTGAAAACCACAAATCTCACTTCTG
GACAATATTTATCAAGGTTTTTAGCCAACACCACTTTCAGAGGTCTCAGTGGTTCCATCAAAGTAAAGGG
ATCCACCATCGTCAGCTCAGAAAACAACTTTTTCATCTGGAACTTGCAGTATGACCCTATGGGAAAGCCA
ATGTGGACTCGCCTGGGTAGCTGGCAAGGGGGAAGGATTGTCATGGACTCGGGAATATGGCCAGAGCAGG
CCCAGAGGCACAAAACCCACTTCCATCACCCAAACAAGTTACACTTGAGAGTGGTGACACTGATTGAACA
TCCATTTGTTTTCACGAGAGAAGTAGATGATGAAGGCTTATGCCCTGCTGGACAACTCTGTCTAGACCCT
ATGACTAATGACTCTTCCATACTGGATAGCCTGTTTAGCAGCCTACATAGCAGTAATGATACAGTGCCAA
TCAAGTTCAAGAAGTGCTGCTATGGGTATTGCATTGATCTACTGGAACAGTTAGCAGAAGACATGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 162902. Forward Primer - name:162902_F_cDNA_mCG120729, sequence:CCAGCTGGAAAACATTAGGAAC; Reverse Primer - name:162902_N_SP6_cDNA_mCG120729, sequence:TCATGTCTTCTGCTAACTGTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_015836 same experiment
 EMAGE:29859 same embryo
 EMAGE:32085 same embryo
 EMAGE:30355 same embryo
 EMAGE:31387 same embryo
 EMAGE:30341 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS