Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32080

Fdft1 farnesyl diphosphate farnesyl transferase 1 ( MGI:102706)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32080 EMAGE:32080 EMAGE:32080 EMAGE:32080 EMAGE:32080
euxassay_002771_01 euxassay_002771_02 euxassay_002771_03 euxassay_002771_04 euxassay_002771_05
EMAGE:32080 EMAGE:32080 EMAGE:32080 EMAGE:32080 EMAGE:32080
euxassay_002771_06 euxassay_002771_07 euxassay_002771_08 euxassay_002771_09 euxassay_002771_10
EMAGE:32080 EMAGE:32080 EMAGE:32080 EMAGE:32080 EMAGE:32080
euxassay_002771_11 euxassay_002771_12 euxassay_002771_13 euxassay_002771_14 euxassay_002771_15
EMAGE:32080 EMAGE:32080 EMAGE:32080 EMAGE:32080 EMAGE:32080
euxassay_002771_16 euxassay_002771_17 euxassay_002771_18 euxassay_002771_19 euxassay_002771_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 19 20
nucleus pulposus
strong strong
regionalstrong expression: see section 11 12 13
cervical ganglion
strong strong
regionalstrong expression: see section 07 13
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 14 15 16
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 08 13
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 04 05 15
thoracic ganglion
strong strong
regionalstrong expression: see section 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3857
Entity Detected:Fdft1, farnesyl diphosphate farnesyl transferase 1 ( MGI:102706)
Sequence:sense strand is shown

>T3857
TGGCCTCGAGCCAGATTCGGCACGAGGGTGGGAGCGGGAGATCCCGACAGGTGAGCCCCGCGCCCAGCAG
TCGCAAGGATGGAGTTCGTCAAGTGTCTAGGCCACCCGGAGGAGTTCTATAACCTGCTGCGATTCCGCAT
GGGAGGCCGGCGGAATTTTATACCCAAGATGGACCAGGACTCACTCAGCAGCAGCTTGAAGACCTGCTAC
AAGTATCTCAATCAGACCAGTCGCAGCTTTGCCGCGGTTATCCAGGCGCTGGATGGGGACATACGGCACG
CCATATGTGTGTTCTACCTGGTTCTCCGAGCCCTGGATACAGTGGAGGATGACATGAGCATCAGTGTGGA
GAAGAAGATCCCACTGCTGTGTAACTTCCACACTTTCCTCTATGACCCAGAGTGGCGGTTCACTGAGAGC
AAGGAGAAGGACCGACAAGTGCTGGAGGACTTCCCCACGATCTCCCTGGAGTTTAGAAATTTGGCTGAGA
AATATCAAACAGTGATCGATGACATCTGCCACCGGATGGGGTGTGGGATGGCAGAATTTGTAGACAAG
Notes:The probe template was PCR amplified from IMAGE:424562 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:424562 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002771 same experiment
 EMAGE:32079 same assay
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS