Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32107

Gpr56 G protein-coupled receptor 56 ( MGI:1340051)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32107 EMAGE:32107 EMAGE:32107 EMAGE:32107 EMAGE:32107
euxassay_003287_01 euxassay_003287_02 euxassay_003287_03 euxassay_003287_04 euxassay_003287_05
EMAGE:32107 EMAGE:32107 EMAGE:32107 EMAGE:32107 EMAGE:32107
euxassay_003287_06 euxassay_003287_07 euxassay_003287_08 euxassay_003287_09 euxassay_003287_10
EMAGE:32107 EMAGE:32107 EMAGE:32107 EMAGE:32107 EMAGE:32107
euxassay_003287_11 euxassay_003287_12 euxassay_003287_13 euxassay_003287_14 euxassay_003287_15
EMAGE:32107 EMAGE:32107 EMAGE:32107 EMAGE:32107 EMAGE:32107
euxassay_003287_16 euxassay_003287_17 euxassay_003287_18 euxassay_003287_19 euxassay_003287_20
EMAGE:32107 EMAGE:32107 EMAGE:32107
euxassay_003287_21 euxassay_003287_22 euxassay_003287_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
foregut-midgut junction
strong strong
regionalstrong expression: see section 13 15 16 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 08 09 18 19 20
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 17 18
spinal cord
strong strong
homogeneousstrong expression: see section 11 12 13 14 15 16 17 18
rectum
strong strong
regionalstrong expression: see section 13
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14
testis
strong strong
regionalstrong expression: see section 06 07 08 09 20 21 22 23
left lung
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12 13
bladder
moderate moderate
regionalmoderate expression: see section 13 14
esophagus
strong strong
regionalstrong expression: see section 13 14 15
pancreas
strong strong
regionalstrong expression: see section 10 11 12 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 20
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 21 22 23
upper jaw molar
strong strong
regionalstrong expression: see section 08 20 not examined expression: see section 07
trachea
strong strong
regionalstrong expression: see section 14 15
thymus primordium
strong strong
homogeneousstrong expression: see section 13 14 15 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 17 18 19 20 21 22 23
posterior naris
strong strong
regionalstrong expression: see section 13 15 16
kidney pelvis
strong strong
regionalstrong expression: see section 10 19
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 20 21 22 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 14 15 16 17 18 19
hindgut
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
cervical ganglion
moderate moderate
regionalmoderate expression: see section 11 18
naris
strong strong
regionalstrong expression: see section 17
neural retina
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 23
liver right lobe
strong strong
regionalstrong expression: see section 15 16 17 18 19 20 21 22 23
right lung
strong strong
spottedstrong expression: see section 14 15 16 17 18 19 20 21 22 23
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13
kidney calyx
strong strong
regionalstrong expression: see section 06 08 09 12 17 18 20 21 22
thyroid cartilage
strong strong
regionalstrong expression: see section 13 14
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14
brain
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 19 20
anterior naris
strong strong
regionalstrong expression: see section 13 16
midgut
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 15 16 17 18 19
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 12 17 18 19 20 21
liver left lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14
lower jaw incisor
strong strong
regionalstrong expression: see section 13 16 17 18
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1060
Entity Detected:Gpr56, G protein-coupled receptor 56 ( MGI:1340051)
Sequence:sense strand is shown

>T1060
GTTGGCCTACTGGTCCGAGCTTCATCTTCTCCTTCCACAATGCCCCACACAAGGTCTCCCACAATGCATC
TGTGGACATGTGTGATCTCAAGAAGGAATTGCAGCAGCTTAGCAGGTACCTGCAGCACCCTCAAAAGGCT
GCCAAGCGGCCCACCGCAGCGTTCATCAGCCAGCAGTTACAGAGCCTGGAGTCAAAGCTGACCTCTGTGA
GCTTCCTGGGAGACACATTATCCTTTGAGGAGGACCGGGTCAATGCTACAGTGTGGAAGCTGCCACCCAC
AGCCGGTCTAGAGGATCTGCATATCCACTCCCAGAAGGAGGAGGAGCAGAGTGAGGTCCAGGCATACTCG
CTGTTGCTTCCCCGGGCCGTATTCCAGCAGACCAGAGGCCGTCGCCGGGATGACGCCAAGAGGCTCCTGG
TAGTAGACTTCAGCAGCCAAGCTTTGTTCCAGGACAAGAATTCTAGCCAAGTCCTGGGTGAGAAGGTCTT
GGGTATTGTCGTGCAGAACACCAAAGTCACCAACCTCTCAGATCCGGTGGTACTCACCTTCCAGCACC
Notes:The probe template was PCR amplified from IMAGE:2099401 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2099401 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003287 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS