EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32125

Mllt4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 ( MGI:1314653)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_016331_01	euxassay_016331_02	euxassay_016331_03	euxassay_016331_04	euxassay_016331_05

euxassay_016331_06	euxassay_016331_07	euxassay_016331_08	euxassay_016331_09	euxassay_016331_10

euxassay_016331_11	euxassay_016331_12	euxassay_016331_13	euxassay_016331_14	euxassay_016331_15

euxassay_016331_16	euxassay_016331_17	euxassay_016331_18	euxassay_016331_19	euxassay_016331_20

euxassay_016331_21	euxassay_016331_22	euxassay_016331_23	euxassay_016331_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Text Annotation:

Structure

Level

Pattern

Notes

midbrain mantle layer

weak

regional

weak expression: see section 12 13 14 15

Annotation Validation:

text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T45132
Entity Detected:	Mllt4, myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 ( MGI:1314653)
Sequence:	sense strand is shown >T45132 CTGGAGGAAGAACGAGAGAGAAAGCGCAGGGAGCAGGAGCGGAAGTTGGGGCAGATGCGCTCTCAGACCC TGAACCCTGCTTCCTTCTCACCTTTGGCCACACAGGCCAAGCCAGAAAAGCCTTCCACACTGCAGAGGCC CCAAGAAACAGTCATTCGGGAGCTTCAGCCCCAGCAGCAGCCCCGCACGATCGAGCGCAAGGATCTGCAG TATATAACCATCAGTAAAGAGGAGCTGTCCTCTGGTGATAGTCTGTCTCCAGACCCCTGGAAACGAGATG CCAGGGAGAAGCTGGAGAAGCAACAGCAAATGCACATTGTGGACATGCTAAGCAAGGAGATCCACGAGCT GCAAAACAAGGTGGACCGTACTGCGGAGGAGAGTGACCGCCTGCGGAAGCTTATGCTGGAGTGGCAGTTC CAGAAGAGACTACAG
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 207167207167. Forward Primer - name:207167_F_exon_Mllt4, sequence:CTGGAGGAAGAACGAGAGAGAA; Reverse Primer - name:207167_N_SP6_exon_Mllt4, sequence:CTGTAGTCTCTTCTGGAACTGCC.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_016331 same experiment
	EMAGE:29901 same embryo
	EMAGE:29220 same embryo
	EMAGE:29896 same embryo
	EMAGE:29884 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source