Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32149

Six3os1 Six3 opposite strand transcript 1 ( MGI:1925118)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32149 EMAGE:32149 EMAGE:32149 EMAGE:32149 EMAGE:32149
euxassay_014141_01 euxassay_014141_02 euxassay_014141_03 euxassay_014141_04 euxassay_014141_05
EMAGE:32149 EMAGE:32149 EMAGE:32149 EMAGE:32149 EMAGE:32149
euxassay_014141_06 euxassay_014141_07 euxassay_014141_08 euxassay_014141_09 euxassay_014141_10
EMAGE:32149 EMAGE:32149 EMAGE:32149 EMAGE:32149 EMAGE:32149
euxassay_014141_11 euxassay_014141_12 euxassay_014141_13 euxassay_014141_14 euxassay_014141_15
EMAGE:32149 EMAGE:32149 EMAGE:32149 EMAGE:32149 EMAGE:32149
euxassay_014141_16 euxassay_014141_17 euxassay_014141_18 euxassay_014141_19 euxassay_014141_20
EMAGE:32149 EMAGE:32149 EMAGE:32149
euxassay_014141_21 euxassay_014141_22 euxassay_014141_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 17
telencephalon mantle layer
strong strong
regionalstrong expression: see section 07 19 20 21 moderate expression: see section 10 18 22
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 15 16 17 18
pituitary gland
strong strong
regionalstrong expression: see section 09 10 11 12 13
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 14 15 16
anterior naris epithelium
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 12 13 14 15
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
external naris epithelium
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40369
Entity Detected:Six3os1, Six3 opposite strand transcript 1 ( MGI:1925118)
Sequence:sense strand is shown

>T40369
CTTTGAGTGACCCTCATTAGCCTGGCGCCCTGCTAAGGCCCCACCATTGCAAAAAAGCTGCTGGGCCCGG
CATTTGTACGCCTTGTTAGCGCTGCTTAATGAAGCCGCCCCGACGGCTCAAAGGCGGCCTCTGGGGCCGG
CAGCGCGCACCTCTCGGCACCCCGCTCTGCCTAATGAGCCCCGCCGCCCGCTAAAGGCCCTTCCACCCCC
CACATCCTCAAACAAGAGGGGTTTGGCTCCGTCTAGGACCTGAACACCTCCCACCACCGGGCCCAGGAGG
GTGGGCACAAACCCAGTCTAGCTGGCTACACGGTGATCTAGCCCCTGGAGAAAGAAGCCAGCTACTTGGA
GTATGCAAGCTAAAAATGGTTGTGTGAGTGGGAAAGTAGGGAAGTGGATTTTACAGCCACTAGGTCTAGC
TCACCCGTGGGTACCACGAACTTTCCCCCACAGGGCCAGCTGTAAATCAATTAACCAGCCCAGCTCCTTA
AAGGTGCATCTGGACTAGTGTTAGAACGTCAGAAGGGCTGGTACACAGGGGAGGGTCAGCTTTCCACTCC
CCCCTCAAATTCCTTTGCTCTGGTCTCCCCAGGAGGCCTGGCACTTCTCCCCAGGTGGCCTCACACTTTC
TGGAAGGTCAACCTTCCAGGCAACTAGAACTCTAGGCCTGTATTTGAGAAAGGATGGGCAGGTTCAGTTC
ACACCCCTCGGAGAATGACTTCCAGTTTCACACAATCCCATCCCTGGTCTCTCTTCCATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93584. Forward Primer - name:093584_F_cDNA_E130112H22Rik, sequence:CTTTGAGTGACCCTCATTAGCC; Reverse Primer - name:093584_N_SP6_cDNA_E130112H22Rik, sequence:AATGGAAGAGAGACCAGGGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014141 same experiment
 EMAGE:29902 same embryo
 EMAGE:29872 same embryo
 EMAGE:29875 same embryo
 EMAGE:30346 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS