Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32150

Atp5k ( MGI:106636)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32150 EMAGE:32150 EMAGE:32150 EMAGE:32150 EMAGE:32150
euxassay_016567_01 euxassay_016567_02 euxassay_016567_03 euxassay_016567_04 euxassay_016567_05
EMAGE:32150 EMAGE:32150 EMAGE:32150 EMAGE:32150 EMAGE:32150
euxassay_016567_06 euxassay_016567_07 euxassay_016567_08 euxassay_016567_09 euxassay_016567_10
EMAGE:32150 EMAGE:32150 EMAGE:32150 EMAGE:32150 EMAGE:32150
euxassay_016567_11 euxassay_016567_12 euxassay_016567_13 euxassay_016567_14 euxassay_016567_15
EMAGE:32150 EMAGE:32150 EMAGE:32150 EMAGE:32150 EMAGE:32150
euxassay_016567_16 euxassay_016567_17 euxassay_016567_18 euxassay_016567_19 euxassay_016567_20
EMAGE:32150 EMAGE:32150
euxassay_016567_21 euxassay_016567_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 10 11 12 13
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38954
Entity Detected:Atp5k, ( MGI:106636)
Sequence:sense strand is shown

>T38954
GGTTCAGGTCTCTCCACTCATCAAGTCCGGCCGGTACTCCGCTCTGATCATCGGCATGGCATACGGCGCC
AAGCGCTACAGTTACCTAAAACCCCGGGCAGAGGAGGAGAGGAGAATAGCAGCGGAGGAAAGGAAGAGAC
TAGATGAGTTGAAACGGATTGAGAGAGAACTGGCGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 268887. Forward Primer - name:268887_F_cDNA_Atp5k, sequence:GGTTCAGGTCTCTCCACTCATC; Reverse Primer - name:268887_N_SP6_cDNA_Atp5k, sequence:TCCGCCAGTTCTCTCTCAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016567 same experiment
 EMAGE:32232 same embryo
 EMAGE:32209 same embryo
 EMAGE:30773 same embryo
 EMAGE:30793 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS