Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32156

Nsg1 neuron specific gene family member 1 ( MGI:109149)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156
euxassay_003024_01 euxassay_003024_02 euxassay_003024_03 euxassay_003024_04 euxassay_003024_05
EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156
euxassay_003024_06 euxassay_003024_07 euxassay_003024_08 euxassay_003024_09 euxassay_003024_10
EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156
euxassay_003024_11 euxassay_003024_12 euxassay_003024_13 euxassay_003024_14 euxassay_003024_15
EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156
euxassay_003024_16 euxassay_003024_17 euxassay_003024_18 euxassay_003024_19 euxassay_003024_20
EMAGE:32156 EMAGE:32156 EMAGE:32156 EMAGE:32156
euxassay_003024_21 euxassay_003024_22 euxassay_003024_23 euxassay_003024_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 19 20 21
facial vii ganglion
strong strong
regionalstrong expression: see section 23 24 moderate expression: see section 06
vagus x ganglion
strong strong
regionalstrong expression: see section 20 moderate expression: see section 10
trigeminal v ganglion
strong strong
regionalstrong expression: see section 19 20 21 22 23 24 moderate expression: see section 05 06 07 08 09 10 11
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 10 11 16 17 18 19 weak expression: see section 20
cervical ganglion
strong strong
regionalstrong expression: see section 11 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 20 21 22 moderate expression: see section 08 09 10
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 12 13 19
spinal cord
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16 17 18 19 20
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 20 21 moderate expression: see section 08 09
thoracic ganglion
strong strong
regionalstrong expression: see section 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1050
Entity Detected:Nsg1, neuron specific gene family member 1 ( MGI:109149)
Sequence:sense strand is shown

>T1050
CTGGATTGCTGTGCGCGGGAGCGGGCGACACTGAGCCTCGGAGCGCGCTTGGAGCCCAGATCTTCTGGAG
CCAGGCGTGGGGCCGCAGCCTCGTGTCCTTCGCAACCATGGTGAAGTTGGGGAATAATTTCGCAGAGAAG
GGCACCAAGCAGCCACTGCTGGAGGATGGCTTCGACACCATTCCTTTGATGACGCCCCTCGATGTCAACC
AGCTGCAGTTCNCACCCCCAGATAAGGTCGTGGTGAAAACTAAGACTGAATATGAACCTGATCGCAAAAA
AGGAAAAGCACGTCCTCCCAAGATAGCCGAGTTCACCGTCAGCATCACCGAGGGTGTCACCGAGAGGTTT
AAGGTCTCCGTGCTGGTCCTCTTTGCCCTGGCCTTCCTCACCTGTGTCGTCTTCCTGGTTGTCTACAAAG
TGTACAAGTATGACCGCGCCTGCCCTGATGGGTTTGTCTTGAAGAACACCCAGTGCATCCCAGAAGGCTT
GGAGAGCTACTACACGGAGCAAGACTCCAGTGCCCGGGAGAAATTTTACACTGTCATAAACCACTA
Notes:The probe template was PCR amplified from IMAGE:2088330 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2088330 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003024 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS