Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32159

Rhpn1 ( MGI:1098783)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32159 EMAGE:32159 EMAGE:32159 EMAGE:32159 EMAGE:32159
euxassay_003267_01 euxassay_003267_02 euxassay_003267_03 euxassay_003267_04 euxassay_003267_05
EMAGE:32159 EMAGE:32159 EMAGE:32159 EMAGE:32159 EMAGE:32159
euxassay_003267_06 euxassay_003267_07 euxassay_003267_08 euxassay_003267_09 euxassay_003267_10
EMAGE:32159 EMAGE:32159 EMAGE:32159 EMAGE:32159 EMAGE:32159
euxassay_003267_11 euxassay_003267_12 euxassay_003267_13 euxassay_003267_14 euxassay_003267_15
EMAGE:32159 EMAGE:32159 EMAGE:32159 EMAGE:32159 EMAGE:32159
euxassay_003267_16 euxassay_003267_17 euxassay_003267_18 euxassay_003267_19 euxassay_003267_20
EMAGE:32159 EMAGE:32159 EMAGE:32159
euxassay_003267_21 euxassay_003267_22 euxassay_003267_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 3 mesenchyme
weak weak
regionalweak expression: see section 03 04 23
pectoral girdle and thoracic body wall musculature
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 16 17
hindlimb digit 1 mesenchyme
weak weak
regionalweak expression: see section 04
hindlimb digit 4 mesenchyme
weak weak
regionalweak expression: see section 03 04 23
clavicle
weak weak
regionalweak expression: see section 10 11 17
axial skeleton
weak weak
regionalweak expression: see section 12 13 14 15 16 17 18
testis
strong strong
regionalstrong expression: see section 07 08 09 10 20 21 22 23
hindlimb digit 2 mesenchyme
weak weak
regionalweak expression: see section 03 04 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T226
Entity Detected:Rhpn1, ( MGI:1098783)
Sequence:sense strand is shown

>T226
GCGCGGCTGATCCTCCCTGGAGCGCGAGGGGCCTGCTGCTCGCAGCCTCTCGGAGTCAGCGTCCGAGCGA
GCAGCGATGATCCTTGAGGAGAGGCCAGATGGCCAGGGCACTGGCGAGGAAAGCTCTCGGCCGCAGGACG
ACGGCAGCATCCGCAAGGGCTATGGCTCCTTTGTGCAAAACCAGCCTGGCCAGCTGCAGAGTCACAGGGC
TCGGCTCCACCAGCAGATCAGCAAGGAGCTCCGGATGCGGACCGGTGCTGAAAACCTCTACAGAGCCACC
AGCAACACCTGGGTCCGAGAAACAGTCGCACTGGAGCTGAGCTACGTCAACTCCAACCTGCAGCTGCTGA
AAGAGGAGCTGGCAGAGCTGAGCACCAGCGTAGATGTGGACCAGCCAGAGGGCGAAGGGATTACTATTCC
CATGATCCCCCTGGGGCTGAAGGAAACCAAGGAGTTGGACTGGGCCACACCGCTGAAGGAGCTGAT
Notes:The probe template was PCR amplified from IMAGE:2650008 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2650008 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003267 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS