Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32168

Mapre2 ( MGI:106271)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32168 EMAGE:32168 EMAGE:32168 EMAGE:32168 EMAGE:32168
euxassay_007836_01 euxassay_007836_02 euxassay_007836_03 euxassay_007836_04 euxassay_007836_05
EMAGE:32168 EMAGE:32168 EMAGE:32168 EMAGE:32168 EMAGE:32168
euxassay_007836_06 euxassay_007836_07 euxassay_007836_08 euxassay_007836_09 euxassay_007836_10
EMAGE:32168 EMAGE:32168 EMAGE:32168 EMAGE:32168 EMAGE:32168
euxassay_007836_11 euxassay_007836_12 euxassay_007836_13 euxassay_007836_14 euxassay_007836_15
EMAGE:32168 EMAGE:32168 EMAGE:32168 EMAGE:32168 EMAGE:32168
euxassay_007836_16 euxassay_007836_17 euxassay_007836_18 euxassay_007836_19 euxassay_007836_20
EMAGE:32168 EMAGE:32168 EMAGE:32168
euxassay_007836_21 euxassay_007836_22 euxassay_007836_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 20 21
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12 16 17
forebrain
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 01 02 03 04 05 21 22 23
spinal cord
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14 15 16 17 18
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 15
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 17 18 19
midbrain
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 21
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 moderate expression: see section 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 16 17
hindbrain
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 05 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3150
Entity Detected:Mapre2, ( MGI:106271)
Sequence:sense strand is shown

>T3150
AATTCGGNCGAGGGGAATCCTTCGCAGCTATTTCCACCCCTGCCTCTGGGCACCCACCACTCACGGATGG
CAGAACCCATTCAGTCTCCTACCTTGCATTCAGGATGCACAGTTCTCTAAGTCCTGGCCAGCCCCAGCTC
ATCACATTGGGTCCACAGGCATCCCAGCATGGGTCCCTGCGCCTCCCTCTCAAGGAGTTGATTTTTTTTC
CCCTCAGTTTCCCCACACCCACTGTTGGCTGGAAGTGCTTCCATTACCACTGTCAGATTGGAAGTGACCG
AAGCAGGGGATGAAGAGAAAGCTCACATTCTAAGTAGAGAAGCAGGAAAAATTGTTCAAAAGACAAACAC
CCTGTTGAACTGAGAGAAGTAAACTCCAGAAGGGAACCAAGATTTCCTCCCTTTCCTGGTGAGTGTTTCC
ATTATTCCGTTAAGGTTTAATATGCATTCAGATTACTTTTACTGAATAGTTACACCATAAAGCTTTTGTT
ATATATTAAATGTAAACTGAAAGGAATGTAAACATATGTA
Notes:The probe template was PCR amplified from IMAGE:1547905 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547905 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007836 same experiment
 EMAGE:29915 same embryo
 EMAGE:32110 same embryo
 EMAGE:29914 same embryo
 EMAGE:32170 same embryo
 EMAGE:29893 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS