Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32170

Itpk1 ( MGI:2446159)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32170 EMAGE:32170 EMAGE:32170 EMAGE:32170 EMAGE:32170
euxassay_007834_01 euxassay_007834_02 euxassay_007834_03 euxassay_007834_04 euxassay_007834_05
EMAGE:32170 EMAGE:32170 EMAGE:32170 EMAGE:32170 EMAGE:32170
euxassay_007834_06 euxassay_007834_07 euxassay_007834_08 euxassay_007834_09 euxassay_007834_10
EMAGE:32170 EMAGE:32170 EMAGE:32170 EMAGE:32170 EMAGE:32170
euxassay_007834_11 euxassay_007834_12 euxassay_007834_13 euxassay_007834_14 euxassay_007834_15
EMAGE:32170 EMAGE:32170 EMAGE:32170 EMAGE:32170 EMAGE:32170
euxassay_007834_16 euxassay_007834_17 euxassay_007834_18 euxassay_007834_19 euxassay_007834_20
EMAGE:32170 EMAGE:32170
euxassay_007834_21 euxassay_007834_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 13 14 15 16 17 18 moderate expression: see section 10 11 12 19 weak expression: see section 01 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 09
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 13 14 15 16 17 18 moderate expression: see section 10 11 12 19 weak expression: see section 01 20 21 22
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 weak expression: see section 20 21
midgut loop mesentery
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11
vibrissa
moderate moderate
regionalmoderate expression: see section 01 02 03 04 15 16 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 18
midgut
weak weak
regionalweak expression: see section 12 13 14 15 16
stomach mesentery
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 weak expression: see section 08
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3151
Entity Detected:Itpk1, ( MGI:2446159)
Sequence:sense strand is shown

>T3151
NNGGCTCTGGGACCGAGGAAGGAAGCCCATATCTGGCCAGGCTGTTGCAGCTAAGCAGGCGAAGGACGAA
CGGTTTTCCCAGTTCCCCTCCTCTTCACACCTGCCCACACCCAGACCTCACCCTCCCTCTTGTCCCAGAT
GTGCTCTCCTCCAAGGCTAACCCTTGCCCCCCCACCTCGCTCTCCAAAGCCAGGGAAGCAGTAGACGCCC
CCTCGGGAGCTCTGCATGGAGGATCTGGGTTGTAGGAAGGGAAAGGAGCTTCCTGTGGGTGTAGCCGAAG
CCCACTGGCTATTGCTAGTCTTCACTGGCTCGTGGAATACAGCAGGCCACTATCCACCCTACCCTGACCC
TATTGCTCACTGAGATCCAGGAAGGAGCCATCTGACTAGGAGTCCAGGAGTCTGCCAGGACCCAGGATTT
ACCCTGGGACTTCCAACAGATCATTCCGTGAGTCTTCAGGCCTCCACCACCTCATCTCTTCAGGGTGGCT
CCTGAAA
Notes:The probe template was PCR amplified from IMAGE:1547922 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547922 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007834 same experiment
 EMAGE:29915 same embryo
 EMAGE:32110 same embryo
 EMAGE:29914 same embryo
 EMAGE:29893 same embryo
 EMAGE:32168 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS