Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32172

Sorl1 sortilin-related receptor, LDLR class A repeats-containing ( MGI:1202296)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172
euxassay_012191_01 euxassay_012191_02 euxassay_012191_03 euxassay_012191_04 euxassay_012191_05
EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172
euxassay_012191_06 euxassay_012191_07 euxassay_012191_08 euxassay_012191_09 euxassay_012191_10
EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172
euxassay_012191_11 euxassay_012191_12 euxassay_012191_13 euxassay_012191_14 euxassay_012191_15
EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172
euxassay_012191_16 euxassay_012191_17 euxassay_012191_18 euxassay_012191_19 euxassay_012191_20
EMAGE:32172 EMAGE:32172 EMAGE:32172 EMAGE:32172
euxassay_012191_21 euxassay_012191_22 euxassay_012191_23 euxassay_012191_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
rectum
moderate moderate
regionalmoderate expression: see section 13
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
ureter
moderate moderate
regionalmoderate expression: see section 08 11 13 14 15
left lung
strong strong
regionalstrong expression: see section 03 moderate expression: see section 04 05 06 07 08 09 10
bladder
moderate moderate
regionalmoderate expression: see section 12 13 14
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
trachea
moderate moderate
regionalmoderate expression: see section 13
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 16 17 18 19 20 21 22 23 24 moderate expression: see section 09 10 11 12 14 15
kidney pelvis
moderate moderate
regionalmoderate expression: see section 07 16
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 17
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 13 14 15 16 17 18
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
right lung
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 22
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10
kidney calyx
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 14 15 16 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 11 14
midgut
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15 16 17 18 19
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 16 17 18 moderate expression: see section 09 10 11 12 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37070
Entity Detected:Sorl1, sortilin-related receptor, LDLR class A repeats-containing ( MGI:1202296)
Sequence:sense strand is shown

>T37070
GGTTGGAGAGAGCATATGGAAGACCCTGGAAACCCACAGCAATAAAACAAGCACTGTGCTCAAGGTCCTG
AAGCCAGACACCACGTACCAGGTTAAGGTCCAGGTGCACTGCCTCAACAAGGTGCACAACACCAATGACT
TTGTGACCCTCAGGACTCCAGAAGGGTTGCCAGATGCCCCTCGGAATCTCCAGCTCTCCCTGAACAGGGA
AGAGGAAGGTGTGATTCTCGGGCACTGGGCTCCTCCCGTCCACACCCATGGCCTCATCCGTGAGTACATT
GTGGAATACAGCAGGAGTGGGTCCAAGATGTGGGCCTCCCAGAGAGCTGCTAGCAACTCTACAGAAATAA
AGAACTTACTGCTCAATGCCCTCTACACTGTCAGAGTGGCTGCGGTGACTAGTCGTGGGATAGGAAACTG
GAGTGATTCTAAGTCCATCACCACCATAAAAGGAAAAGTGATCCAAGCACCAAATATCCACATTGACAGC
TACGATGAAAATTCTCTGAGCTTTACCCTGACCATGGATGGTGACATCAAGGTCAATGGCTACGTGGTGA
ACCTTTTCTGGTCATTTGATGCCCACAAACAAGAAAAGAAAACCCTGAGCTTCCGCGGAGGGAGTGCACT
GTCACACAAAGTTAGCAACCTGACAGCTCATACATCCTATGAGATTTCTGCCTGGGCCAAGACAGACTTG
GGAGATAGCCCACTGGCCTTTGAGCACATCTTGACCAGAGGCAGCAGTCCACCAGCTCCTAGTCTCAAAG
CCAAGGCCATCAATCAGACTGCAGTGGAGTGCATCTGGACTGGCCCCAAGAATGTGGTGTATGGTAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64230. Forward Primer - name:064230_F_cDNA_Sorl1, sequence:GGTTGGAGAGAGCATATGGAAG; Reverse Primer - name:064230_N_SP6_cDNA_Sorl1, sequence:ATACCATACACCACATTCTTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012191 same experiment
 EMAGE:30746 same embryo
 EMAGE:32171 same embryo
 EMAGE:31469 same embryo
 EMAGE:32169 same embryo
 EMAGE:30763 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS