Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32174

Cldn22 ( MGI:1922927)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32174 EMAGE:32174 EMAGE:32174 EMAGE:32174 EMAGE:32174
euxassay_012199_01 euxassay_012199_02 euxassay_012199_03 euxassay_012199_04 euxassay_012199_05
EMAGE:32174 EMAGE:32174 EMAGE:32174 EMAGE:32174 EMAGE:32174
euxassay_012199_06 euxassay_012199_07 euxassay_012199_08 euxassay_012199_09 euxassay_012199_10
EMAGE:32174 EMAGE:32174 EMAGE:32174 EMAGE:32174 EMAGE:32174
euxassay_012199_11 euxassay_012199_12 euxassay_012199_13 euxassay_012199_14 euxassay_012199_15
EMAGE:32174 EMAGE:32174 EMAGE:32174 EMAGE:32174 EMAGE:32174
euxassay_012199_16 euxassay_012199_17 euxassay_012199_18 euxassay_012199_19 euxassay_012199_20
EMAGE:32174 EMAGE:32174 EMAGE:32174
euxassay_012199_21 euxassay_012199_22 euxassay_012199_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
utricle
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 20 21 weak expression: see section 06 07 18 19
cochlea
weak weak
regionalweak expression: see section 06 07 08 09 16 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37639
Entity Detected:Cldn22, ( MGI:1922927)
Sequence:sense strand is shown

>T37639
AACCTTAACTTGGAGCTGAACGAGATGGAGAACTGGACCATGGGGCTCTGGAAATCCTGCGTCATCCAGG
AGGAAGTCGGGAGGCAATGCAAGGACTTTGACTCCTTCCTGGCCTTGCCAGCTGAACTGCAGGTCTCCAG
GGTCTTGATGTCCCTGTGCAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 81313. Forward Primer - name:081313_F_cDNA_Cldn22, sequence:AACCTTAACTTGGAGCTGAACG; Reverse Primer - name:081313_N_SP6_cDNA_Cldn22, sequence:GTTGCACAGGGACATCAAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012199 same experiment
 EMAGE:32175 same assay
 EMAGE:30758 same embryo
 EMAGE:32175 same embryo
 EMAGE:31307 same embryo
 EMAGE:31305 same embryo
 EMAGE:29457 same embryo
 EMAGE:31304 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS