Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32194

Nbl1 neuroblastoma, suppression of tumorigenicity 1 ( MGI:104591)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32194 EMAGE:32194 EMAGE:32194 EMAGE:32194 EMAGE:32194
euxassay_005665_01 euxassay_005665_02 euxassay_005665_03 euxassay_005665_04 euxassay_005665_05
EMAGE:32194 EMAGE:32194 EMAGE:32194 EMAGE:32194 EMAGE:32194
euxassay_005665_06 euxassay_005665_07 euxassay_005665_08 euxassay_005665_09 euxassay_005665_10
EMAGE:32194 EMAGE:32194 EMAGE:32194 EMAGE:32194 EMAGE:32194
euxassay_005665_11 euxassay_005665_12 euxassay_005665_13 euxassay_005665_14 euxassay_005665_15
EMAGE:32194 EMAGE:32194 EMAGE:32194 EMAGE:32194 EMAGE:32194
euxassay_005665_16 euxassay_005665_17 euxassay_005665_18 euxassay_005665_19 euxassay_005665_20
EMAGE:32194
euxassay_005665_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 20
lower leg
strong strong
regionalstrong expression: see section 03 21
forelimb
strong strong
regionalstrong expression: see section 21
upper leg
strong strong
regionalstrong expression: see section 01 02 03 04 16 17 18 19 20 21 moderate expression: see section 14 15
nose
strong strong
regionalstrong expression: see section 08 12 13 16 17 18 19 20 moderate expression: see section 06 09 10 11 weak expression: see section 07
choroid invagination
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
esophagus
moderate moderate
spottedmoderate expression: see section 06 07 08
lower jaw molar
strong strong
regionalstrong expression: see section 06 moderate expression: see section 18
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 02 06 moderate expression: see section 18 weak expression: see section 19
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 21 moderate expression: see section 11
upper lip
moderate moderate
regionalmoderate expression: see section 13 15 16 17 18 weak expression: see section 11 12 14 19
naris
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 moderate expression: see section 11
hand
strong strong
regionalstrong expression: see section 03 04 20 moderate expression: see section 05 06
eyelid
strong strong
regionalstrong expression: see section 01 02 03 04 05
nasal septum
strong strong
regionalstrong expression: see section 14 15
lower lip
moderate moderate
regionalmoderate expression: see section 13 15 16 weak expression: see section 11 12 14
mandible
strong strong
regionalstrong expression: see section 02 03 04
tongue epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
stomach
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 14 15 16 17 18 19 20 21
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
foot
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 07 08 13 14 15 16
naso-lacrimal duct
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 19 20 21
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 15 moderate expression: see section 10 11
upper jaw incisor
strong strong
regionalstrong expression: see section 13
glans of male genital tubercle
strong strong
regionalstrong expression: see section 14 15 16 moderate expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3850
Entity Detected:Nbl1, neuroblastoma, suppression of tumorigenicity 1 ( MGI:104591)
Sequence:sense strand is shown

>T3850
TGGCCTCGAGCAGATTCGGACGAGGCGGNCACAATGCTTTGGGTCCTGGTGGGGGCCGTCCTCCCTGTCA
TGTTGCTGGCTGCCCCGCCACCTATCAACAAGCTGGCCCTGTTTCCGGACAAGAGTGCCTGGTGTGAAGC
CAAGAACATCACGCAGATTGTGGGCCACAGCGGCTGTGAGGCCAAGTCTATCCAGAACAGGGCGTGCCTA
GGACAATGCTTCAGTTACAGCGTCCCCAACACCTTCCCGCAGTCCACAGAGTCCCTGGTGCACTGTGACT
CCTGCATGCCGGCCCAGTCCATGTGGGAGATTGTGACCTTGGAGTGCCCTGGCCACGAGGAGGTGCCCAG
GGTGGACAAACTGGTAGAGAAGATTGTACACTGCAGCTGCCAGGCTTGCGGCAAGGAGCCCAGTCACGAG
GGCCTGAACGTCTATGTGCAGGGTGAAGACAGCCCGGGCTCCCAGCCTGGACCACACTCCCATGCCCATC
CCCACCCTGGGGGCCAGACCCCTGAGCCCGAAGAGCCTCCTGGAGCCCCTCAGGTTGAGGAAGAGGGGGC
T
Notes:The probe template was PCR amplified from IMAGE:423144 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:423144 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005665 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS