Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32198

Trpv4 transient receptor potential cation channel, subfamily V, member 4 ( MGI:1926945)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32198 EMAGE:32198 EMAGE:32198 EMAGE:32198 EMAGE:32198
euxassay_007815_01 euxassay_007815_02 euxassay_007815_03 euxassay_007815_04 euxassay_007815_05
EMAGE:32198 EMAGE:32198 EMAGE:32198 EMAGE:32198 EMAGE:32198
euxassay_007815_06 euxassay_007815_07 euxassay_007815_08 euxassay_007815_09 euxassay_007815_10
EMAGE:32198 EMAGE:32198 EMAGE:32198 EMAGE:32198 EMAGE:32198
euxassay_007815_11 euxassay_007815_12 euxassay_007815_13 euxassay_007815_14 euxassay_007815_15
EMAGE:32198 EMAGE:32198 EMAGE:32198 EMAGE:32198 EMAGE:32198
euxassay_007815_16 euxassay_007815_17 euxassay_007815_18 euxassay_007815_19 euxassay_007815_20
EMAGE:32198 EMAGE:32198 EMAGE:32198
euxassay_007815_21 euxassay_007815_22 euxassay_007815_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 05 06 07
radius
moderate moderate
regionalmoderate expression: see section 01 02
humerus
moderate moderate
regionalmoderate expression: see section 02 03 18 19 20
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 05 06 07
clavicle
moderate moderate
regionalmoderate expression: see section 06 07 08 14 15 weak expression: see section 16
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 08 09 15 16
not examined not examined
regionalnot examined expression: see section 08
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 12 13
tarsus
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 04
viscerocranium
strong strong
regionalstrong expression: see section 06 07 16 17
otic capsule
moderate moderate
regionalmoderate expression: see section 05 06 07 08 14 weak expression: see section 15
trachea
weak weak
regionalweak expression: see section 11
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 05 17
tibia
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 01 02
femur
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 03 04 05 06 07
nasal septum
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 06 16 moderate expression: see section 01 02 03 04 07 17 18 19 20
mandible
moderate moderate
regionalmoderate expression: see section 02 03 08 09 18 19 20 weak expression: see section 04 05 06 07 14 15 16 17
cricoid cartilage
weak weak
regionalweak expression: see section 10 11 12 13
thoracic intervertebral disc
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
temporal bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 16 17 18 19 20
lumbar intervertebral disc
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
palatal shelf
weak weak
regionalweak expression: see section 16
thyroid cartilage
weak weak
regionalweak expression: see section 10 11 12
fibula
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 01 02
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 15 16 17 18 19 20
hindlimb digit 2 mesenchyme
weak weak
regionalweak expression: see section 17
hyoid
weak weak
regionalweak expression: see section 08 09 11 12 13
meckel's cartilage
strong strong
regionalstrong expression: see section 10 11 12 weak expression: see section 07 08 09 13 14
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 16 17 18 19 20
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 03 04 05
cervical intervertebral disc
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
scapula
weak weak
regionalweak expression: see section 01 02 03 18 19 20
maxilla
moderate moderate
regionalmoderate expression: see section 02 03 08 09 18 19 20 weak expression: see section 04 05 06 07 14 15 16 17
sacral vertebral cartilage condensation
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2646
Entity Detected:Trpv4, transient receptor potential cation channel, subfamily V, member 4 ( MGI:1926945)
Sequence:sense strand is shown

>T2646
TGGCTCGAGCCAGATTCGGACGAGGACTGNAGGGGCCGTGCCAGAGCTCGCACAGATAGTCCAGGCTTGG
CCTTCGCTCCCACCTACATTTAGGCATTTGTCCGGTGTCTTCCCACACCCGCATGGGACCTTGGAGGTGA
GGGCCTCTGTGGCGACTCTGTGGAGGCCCCAGGACCCTCTGGTCCCCGCCAAGACTTTTGCCTTCAGCTC
TACTCCCCACATGGGGGGGCGGGGCTCCTGGCTACCTGTCTCGCTCGCTCCCATGGAGTCACCTAAGCCA
GCACAAGGCCCCTCTCCTCGAAAGGCTCAGGCCATCCCTCTTGTGTATTATTTATTGCTCTCCTCAGGAA
AATGGGGTGGCAGGAGTCCACCCGCGGCTGGAACCTGGCCAGGGCTGAAGCTCATGCAGGGACGCTGCAG
CTCCGACCTGCCACAGATCTGACCTGCTGCAGCCCTGGCTAGTGTGGGTCTTCTGTACTTTGAAGAGATC
GGGGCCGCTGGTGCTCAATAAATGTTTATTCTCGGTGGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1433822 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1433822 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007815 same experiment
 EMAGE:29291 same embryo
 EMAGE:32133 same embryo
 EMAGE:29265 same embryo
 EMAGE:29881 same embryo
 EMAGE:29275 same embryo
 EMAGE:29266 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS