Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32200

Serpina3n serine (or cysteine) peptidase inhibitor, clade A, member 3N ( MGI:105045)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32200 EMAGE:32200 EMAGE:32200 EMAGE:32200 EMAGE:32200
euxassay_002129_01 euxassay_002129_02 euxassay_002129_03 euxassay_002129_04 euxassay_002129_05
EMAGE:32200 EMAGE:32200 EMAGE:32200 EMAGE:32200 EMAGE:32200
euxassay_002129_06 euxassay_002129_07 euxassay_002129_08 euxassay_002129_09 euxassay_002129_10
EMAGE:32200 EMAGE:32200 EMAGE:32200 EMAGE:32200 EMAGE:32200
euxassay_002129_11 euxassay_002129_12 euxassay_002129_13 euxassay_002129_14 euxassay_002129_15
EMAGE:32200 EMAGE:32200 EMAGE:32200 EMAGE:32200 EMAGE:32200
euxassay_002129_16 euxassay_002129_17 euxassay_002129_18 euxassay_002129_19 euxassay_002129_20
EMAGE:32200 EMAGE:32200 EMAGE:32200
euxassay_002129_21 euxassay_002129_22 euxassay_002129_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 12 13
axial skeleton lumbar region
strong strong
regionalstrong expression: see section 07 08
axial skeleton sacral region
strong strong
regionalstrong expression: see section 07
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T673
Entity Detected:Serpina3n, serine (or cysteine) peptidase inhibitor, clade A, member 3N ( MGI:105045)
Sequence:sense strand is shown

>T673
TCCTCGAGNCTGTTGGCCTACTGGAACTGCCAGGCAAGCGGCAACCCTGAACATCGGGAGTCAGCTATCA
CAGAGGCTGGCAGCTGGCTGGTTTCAGCTCTGTAGACTGCAGAACACAGAAGATGGCCTTCATTGCAGCT
CTGGGGCTCTTGATGGCTGGGATCTGCCCTGCTGTCCTCTGCTTCCCAGATGGCACGTTGGGAATGGATG
CTGCAGTCCAAGAAGACCATGACAATGGGACACAACTGGACAGTCTCACATTGGCCTCCATCAACACTGA
CTTTGCCTTCAGCCTCTACAAGGAGCTGGTTTTGAAGAATCCAGATAAAAATATTGTCTTCTCCCCACTT
AGCATCTCAGCGGCCTTGGCCGTCATGTCCCTGGGAGCAAAGGGCAACACCCTGGAAGAGATTCTAGAAG
GTCTCAAGTTCAATCTTACAGAGACCTCTGAGGCAGACATCCACCAGGGCTTTGGGCACCTCCTACAGAG
GCTCAACCAGCCAAAGGACCAGGTACAGATCAGCACGGGTAGTGCCCTGTTTATTG
Notes:The probe template was PCR amplified from IMAGE:1888347 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1888347 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002129 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS