Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32203

Cd200r2 ( MGI:3042847)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32203 EMAGE:32203 EMAGE:32203 EMAGE:32203 EMAGE:32203
euxassay_012172_01 euxassay_012172_02 euxassay_012172_03 euxassay_012172_04 euxassay_012172_05
EMAGE:32203 EMAGE:32203 EMAGE:32203 EMAGE:32203 EMAGE:32203
euxassay_012172_06 euxassay_012172_07 euxassay_012172_08 euxassay_012172_09 euxassay_012172_10
EMAGE:32203 EMAGE:32203 EMAGE:32203 EMAGE:32203 EMAGE:32203
euxassay_012172_11 euxassay_012172_12 euxassay_012172_13 euxassay_012172_14 euxassay_012172_15
EMAGE:32203 EMAGE:32203 EMAGE:32203 EMAGE:32203 EMAGE:32203
euxassay_012172_16 euxassay_012172_17 euxassay_012172_18 euxassay_012172_19 euxassay_012172_20
EMAGE:32203 EMAGE:32203 EMAGE:32203
euxassay_012172_21 euxassay_012172_22 euxassay_012172_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 13 14 15 16 moderate expression: see section 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 09 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 16 17 moderate expression: see section 07
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 17 18 19
spinal cord
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 18
retina
strong strong
regionalstrong expression: see section 01 02 03 21 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37621
Entity Detected:Cd200r2, ( MGI:3042847)
Sequence:sense strand is shown

>T37621
TCTTAACTGAGAAGGGCTCCTGTCTAAAGGAAATATGGGGACAAATTGTGGAGCATAGACCAAAAGAAAG
GCCATCCAGAGACTGCCCCACCTAAGGACCCATCCCATATACAGACACCAAACCCAGACACTACTGAAGA
TGCTGCGAAGCGTTTGCTGACAGGAGCCTGTTATAGCTGTCTCCTGAGAGGCTCAGCCAGAGCCTGACAA
ATACATAGGTAGATGCTTGCAGCCAACAACTGGACTGAGCAAAAAATCTCCATTGGAGGAGTTAGAGAAA
GGACTGAAGAGGGTGAAAGGGTTTGCAGCCCCATAGGAAGAACAACAATATCAACCAACCAGATCTCCCA
GAGCTCCCAGGGACTAAATTACCAACCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96774. Forward Primer - name:096774_F_cDNA_Cd200r2, sequence:TCTTAACTGAGAAGGGCTCCTG; Reverse Primer - name:096774_N_SP6_cDNA_Cd200r2, sequence:TGGTTGGTAATTTAGTCCCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012172 same experiment
 EMAGE:30769 same embryo
 EMAGE:30768 same embryo
 EMAGE:32173 same embryo
 EMAGE:31278 same embryo
 EMAGE:31287 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS