Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32215

Plekha5 pleckstrin homology domain containing, family A member 5 ( MGI:1923802)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215
euxassay_005649_01 euxassay_005649_02 euxassay_005649_03 euxassay_005649_04 euxassay_005649_05
EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215
euxassay_005649_06 euxassay_005649_07 euxassay_005649_08 euxassay_005649_09 euxassay_005649_10
EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215
euxassay_005649_11 euxassay_005649_12 euxassay_005649_13 euxassay_005649_14 euxassay_005649_15
EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215
euxassay_005649_16 euxassay_005649_17 euxassay_005649_18 euxassay_005649_19 euxassay_005649_20
EMAGE:32215 EMAGE:32215 EMAGE:32215 EMAGE:32215
euxassay_005649_21 euxassay_005649_22 euxassay_005649_23 euxassay_005649_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 17 18 19 20
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 16
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17 18 19
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 14 15 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 07 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 16 17
midbrain mantle layer
strong strong
regionalstrong expression: see section 11 12
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 11 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3556
Entity Detected:Plekha5, pleckstrin homology domain containing, family A member 5 ( MGI:1923802)
Sequence:sense strand is shown

>T3556
TGGCCTCGAGCCAGATTCGGACGAGGGTCATGCAGCCCTCAGGAAGAGACGGCCATGACAGAGCATCAGA
TGGAAGGCCCCCCTGAGGAAGCAGAGAGTCTTCATGAGGAGGAAGAAACTCTTGCTTCCTGTGAGCCAGC
TCCTGAGATTCCTAGGGAGAATCAAACCACAGTGAGAAGTCTGTCCCCGTCTCCTGACTCCTCCACGGCA
GCAGATCCGCCCACTCCTCCACAGCTCAGGGAAGGATCGCATTTCATGTGTGTGTAGTCGCAGAACTGCA
CTGGCGTCTGTTGAGAGCTCACAGAGCTGAAGCTGTGGACCTCAGTGGTGTAAGAAGATGTACAATATAC
CTTAACTCTATGAAATTCATAGTTCGGATGCTGCTGACCACAGAGCATCATTTTATCACCTTTGGAAAAT
GTTTATTCCAAACTAGCTTTAATGGCCCGTACGTGCACTCCGTAGTGTCAAGGTCACCGTCCTCCGCAGT
CCGCCCACCCGCCCGCTTGCTGCTATTTGAGTTCAGAGCGTATCAGTCAGGTGCTTTC
Notes:The probe template was PCR amplified from IMAGE:3166916 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3166916 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005649 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS