Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3250

Crabp1 cellular retinoic acid binding protein I ( MGI:88490)
TS20 (12.5 dpc)
in situ hybridisation

Data Images
EMAGE:3250 EMAGE:3250
Fig 4A(Crabp) of Dolle et al., 1990 [PMID:1966045] This image is from Dolle, et al., Development 110:1133-1351 (1990), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Fig 4A(brightfield) of Dolle et al., 1990 [PMID:1966045] This image is from Dolle, et al., Development 110:1133-1351 (1990), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image 2 is a brightfield image of an adjacent section to that shown in image 1. Image annotation: arrow marks the boundary between ectoderm-derived and endoderm-derived oral epithelium; t - tongue; m - mandible; tr - trachea; o - oesophagus; h - heart.
Expression Pattern Description
Spatial Annotation:
EMAGE:3250EMAGE:3250Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3250_voxel_strong_3D_1.wlz
3250_voxel_moderate_3D_1.wlz
3250_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3250_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
detected detected
regionalCRABP was expressed in cells located between the trachea and the heart.
trachea
not detected not detected
homogeneous
cardiovascular system
strong strong
regionalTranscripts were strongly expressed in the tissue adjacent to the endocardial cushions and in the walls of large arterial trunks; then were absent from the walls of the vascular trunks in the vicinity of the heart (where CRBP is expressed).
heart
strong strong
regionalTranscripts were strongly expressed in the tissue adjacent to the endocardial cushions and in the walls of large arterial trunks; then were absent from the walls of the vascular trunks in the vicinity of the heart (where CRBP is expressed).
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:14729
Entity Detected:Crabp1, cellular retinoic acid binding protein I ( MGI:88490)
Sequence:sense strand is shown

>MGI:14729
CCAGCGTGCGACCGCTCCGCAGCAGAGGTGGGTGCCTGCCCCTGCCTTCGCGCCGCCGTACAGCCAACAC
CACTGCCACCATGCCCAACTTCGCCGGTACCTGGAAGATGCGCAGCAGCGAGAATTTCGACGAGCTCCTC
AAGGCGTTGGGTGTGAACGCCATGCTGAGGAAGGTGGCCGTGGCGGCTGCGTCTAAGCCGCACGTGGAGA
TCCGCCAAGACGGGGATCAGTTCTACATCAAGACATCCACTACTGTGCGCACCACGGAGATCAACTTCAA
GGTCGGAGAGGGCTTCGAGGAGGAGACAGTGGACGGACGCAAATGCAGGAGTTTACCCACGTGGGAGAAT
GAGAACAAGATTCACTGCACACAGACTCTTCTGGAGGGGGATGGCCCCAAAACTTACTGGACCCGAGAGC
TGGCCAACGATGAGCTCATCCTGACATTTGGCGCCGATGATGTGGTCTGCACGAGGATTTATGTCCGGGA
GTGAAAGGTGGCCAGCTTGTTCCTGCTTCATGACGATGCGAGTTCCCCTGAGGGGTATGCCGTGGCCCCA
CACTGCCAGTGGGTCTTTACTCCACACACCTCTCCCCCATGAATATTAGGCAACCCCATTTTCCCCATGA
CATTGTTGTAGTGTCCTCCCCTCAGGCTCTTGTTGCCTTGTGTACTGTGTACCCTTGTTTGGCATTTGCA
TGATGTACCAGTCATTAAACTGGTTGGCTGC
nt 1 - nt 731 of X15481.1
Notes:The probe used in this study by Dolle et al., 1990 [PMID:1966045] is described as that used by Dolle et al., 1989 [PMID:2556642] , which in turn, is described as a "full length cDNA (Stoner & Gudas, 1989 [PMID:2538228] )". The 0.7kb 'full length clone' of Stoner & Gudas is shown in Fig1 therein (and was deposited in GenBank as X115481).
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:12.5 dpc
Theiler Stage:TS20
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Dolle P; Ruberte E; Leroy P; Morriss-Kay G; Chambon P, 1990 [PMID:1966045] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:1966045] Doll� P, Ruberte E, Leroy P, Morriss-Kay G, Chambon P 1990 Retinoic acid receptors and cellular retinoid binding proteins. I. A systematic study of their differential pattern of transcription during mouse organogenesis. Development (110):1133-51
 [ doi:10.1038/342702a0] [ PMID:2556642] Dolle P, Ruberte E, Kastner P, Petkovich M, Stoner CM, Gudas LJ, Chambon P 1989 Differential expression of genes encoding alpha, beta and gamma retinoic acid receptors and CRABP in the developing limbs of the mouse. Nature (342):702-5
 [ PMID:2538228] Stoner CM, Gudas LJ 1989 Mouse cellular retinoic acid binding protein: cloning, complementary DNA sequence, and messenger RNA expression during the retinoic acid-induced differentiation of F9 wild type and RA-3-10 mutant teratocarcinoma cells. Cancer Res (49):1497-504
Links:MGI:1342268 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI