Type: | in situ hybridisation probe |
Identifier: | MGI:2445989 |
Entity Detected: | Notch1, Notch gene homolog 1 (Drosophila) ( MGI:97363) |
Sequence: | sense strand is shown
>MGI:2445989
AGTGCCGAATGTGAGTGGGATGGCCTAGACTGTGCTGAGCATGTACCCGAGCGGCTGGCAGCGGGCACCC
TGGTCCTGGTGGTGCTGCTTCCACCCGACCAGCTACGGAACAACTCCTTCCACTTTCTGCGGGAGCTCAG
CCACGTGCTGCACACCAACGTGGTCTTCAAGCGTGATGCGCAAGGCCAGCAGATGATCTTCCCGTACTAT
GGCCACGAGGAAGAGCTGCGCAAGCACCCAATCAAGCGCTCTACAGTGGGTTGGGCCACCTCTTCACTGC
TTCCTGGTACC
|
| nt 4729 - nt 5019 of Z11886.1 |
Notes: | In this study by Del Amo et al, 1992 [PMID:1425352] a probe used for RNase protection assays is described in detail as an "EcoRI - KpnI fragment of the Motch cDNA clone c195" which "encodes the last 13 amino acids of the third Notch/lin-12 repeat, as well as the succeeding 84 amino acids of the Motch gene". See Fig 1A therein for sequence. The probe used for in situ hybridisation however is simply described as "a Motch antisense probe", that was hydrolysed to an average size of 0.1kb.
Editor's Note: The probe details entered into the EMAGE database are based on the description of the RNase protection probe above. |
Chemistry: | RNA |
Strand: | antisense |
Label: | S35 |