Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3252

Tll1 tolloid-like ( MGI:106923)
TS11 (7.5 dpc)
in situ hybridisation

Data Images
EMAGE:3252 EMAGE:3252 EMAGE:3252 EMAGE:3252 EMAGE:3252
Figure 4A (3rd from top) of Clark et al., 1999 [PMID:10331975] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 4 (lower panel) of Clark et al., 1999 [PMID:10331975] . Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 4A (3rd from top) of Clark et al., 1999 [PMID:10331975] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 4B (3rd from top) of Clark et al., 1999 [PMID:10331975] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 4B (3rd from top) of Clark et al., 1999 [PMID:10331975] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image annotations: Asterisk indicates the anterior of the embryo. The approximate section planes of A and B are shown in the cartoon.
Expression Pattern Description
Spatial Annotation:
EMAGE:3252EMAGE:3252EMAGE:3252Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3252_voxel_notDetected_3D_1.wlz
3252_voxel_strong_3D_1.wlz
3252_voxel_notDetected_3D_2.wlz
3252_voxel_strong_3D_2.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3252_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
cardiogenic plate
detected detected
spottedExpression was localized to the anterior portion of the embryo, distributed symmetrically to either side of the neural groove in precardiac mesoderm.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:30611
Entity Detected:Tll1, tolloid-like ( MGI:106923)
Sequence:sense strand is shown

>MGI:30611
TCAGAACAGAAAGGAATGTGCATATGGAAAGAAGACATTTTTAAAATAGACAATATTAATACAATTGTTT
TATATAATGAATTTGAGCAAAAGAAACCTGCAAGATTAGAGTTATCTCTGAAGTGAAAGAGAACTTTCCA
GAAAACCTGATTGGCATTGCAAGGATGTTTGAAAGTCATGCTTGTTCAAGGAAGATTAACAGCTTGAAAT
AGATGCTTCACATTTTGGACAGTTCATTTAATGAGCTGTGATTCTCTGGAGTGATTTCTTGACTACTTTT
CCAAGATCTGGGGACGTAGAAATGATGGGACGGATCATAGCTTGGAAACCCACTTCTTGGGTCTTAGCAT
GTTTGCTTAGACTCTGTAGGTCAGACACAGTGTAAACCAAATTCATGTAAGGTGATGTGGAATAGTGGTC
nt 3666 - nt 4085 of U34042.1
Notes:The Tll (Tll-1) probe used in this study by Clark et al., 1999 [PMID:10331975] was a mixture of two antisense riboprobes, corresponding to nucleotides 4283-4681 and nucleotides 3666-4085 of the Tll1 3'-untranslated region, as previously described by Takahara et al., 1996 [PMID:8661043] . Editor's Note: The nucleotide sequence of one of these probes is described above and the other relates to nt4283-nt4681 of the 3' region of U34042.1).
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:7.5 dpc
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Clark et al., 1999 [PMID:10331975] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10331975] Clark TG, Conway SJ, Scott IC, Labosky PA, Winnier G, Bundy J, Hogan BL, Greenspan DS 1999 The mammalian Tolloid-like 1 gene, Tll1, is necessary for normal septation and positioning of the heart. Development (126):2631-42
 [ doi:10.1006/geno.1996.0260] [ PMID:8661043] Takahara K, Brevard R, Hoffman GG, Suzuki N, Greenspan DS 1996 Characterization of a novel gene product (mammalian tolloid-like) with high sequence similarity to mammalian tolloid/bone morphogenetic protein-1. Genomics (34):157-65
Links:MGI:2450521 same experiment
 EMAGE:3283 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI