Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3269

Tdgf1 teratocarcinoma-derived growth factor 1 ( MGI:98658)
TS10 (midstreak Downs & Davies)
in situ hybridisation

Data Images
EMAGE:3269 EMAGE:3269 EMAGE:3269 EMAGE:3269 EMAGE:3269
Fig 5B of Dono et al 1993 [PMID:7916676] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 5B' of Dono et al 1993 [PMID:7916676] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 5C of Dono et al 1993 [PMID:7916676] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 5C' of Dono et al 1993 [PMID:7916676] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 5F of Dono et al 1993 [PMID:7916676] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
The section planes of B and C are depicted in F. Image annotations: ec, embryonic ectoderm; m, mesoderm; ps, primitive streak; a, allantois precursor.
Expression Pattern Description
Spatial Annotation:
EMAGE:3269EMAGE:3269EMAGE:3269Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3269_voxel_possible_3D_1.wlz
3269_voxel_notDetected_3D_1.wlz
3269_voxel_strong_3D_1.wlz
3269_voxel_possible_3D_2.wlz
3269_voxel_notDetected_3D_2.wlz
3269_voxel_strong_3D_2.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3269_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo ectoderm
detected detected
regionalExpression in the ectoderm region proximal to the primitive streak and in all mesodermal cells
embryo mesoderm
detected detected
regionalExpression in the ectoderm region proximal to the primitive streak and in all mesodermal cells
primitive streak
detected detected
regionalStrong expression in cells migrating through the primitive streak
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1335873
Entity Detected:Tdgf1, teratocarcinoma-derived growth factor 1 ( MGI:98658)
Sequence:sense strand is shown

>MGI:1335873
GGCCAGCTCCACTGTCTTCCTCAGACCTTTCTACCTGGCTGTGATGGTCACGTGATGGACCAGGACCTCA
AAGCATCCAGGACTCCGTGTCAAACGCCGTCTGTGACGACCACTTTTATGCTAGCTGGCGCCTGCCTTTT
TCTAGATATGAAAGTTTAGGTGTCATGTGAATTCCATGCCAGTGCCATAGCAAAGATGTCATTCATCTTG
ATGCTCACAGTGAATCCCTAATGTTACCCCTCAAAACACTAACTAGGCCTTTCCTCTGCACGGTCCCTCC
TCTTTCTGGAAAACTATGGCGTGTGT
nt 582 - nt 887 of M87321.1
Notes:The Tdgf1 (cripto) probe used in this study by Dono et al., 1993 [PMID:7916676] is described by the authors as "from nucleotide 357 to 662" of the cripto cDNA (with numbering referring to Fig 1A therein). Editors Note: M87321.1 corresponds to the sequence submitted to GenBank by Dono et al. Nucleotide numbering in the paper is relative to the start codon however numbering in GenBank is from the 5' end of the transcript. The co-ordinates with respect to M87321.1 refer to the GenBank numbering.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:C57BL/6
Age:midstreak Downs & Davies
Theiler Stage:TS10
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Dono R; Scalera L; Pacifico F; Acampora D; Persico MG; Simeone A, 1993 [PMID:7916676] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:7916676] Dono R, Scalera L, Pacifico F, Acampora D, Persico MG, Simeone A 1993 The murine cripto gene: expression during mesoderm induction and early heart morphogenesis. Development (118):1157-68
Links:MGI:1934658 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI