Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3270

Cfc1 cripto, FRL-1, cryptic family 1 ( MGI:109448)
TS11 (early headfold Downs & Davies)
in situ hybridisation

Data Images
EMAGE:3270 EMAGE:3270 EMAGE:3270 EMAGE:3270 EMAGE:3270
Fig 9E of Shen et al, 1997 [PMID:9053319] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 9A of Shen et al, 1997 [PMID:9053319] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 9Bof Shen et al, 1997 [PMID:9053319] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 9C of Shen et al, 1997 [PMID:9053319] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 9D of Shen et al, 1997 [PMID:9053319] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.
EMAGE:3270 EMAGE:3270
Fig 9F of Shen et al, 1997 [PMID:9053319] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 9G of Shen et al, 1997 [PMID:9053319] .Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
The cartoon in A shows the approximate section planes of D/G, C/F and B/E. E. F and G are higher power images of B, C and D respectively. Image annotations: (B) arrowhead = node; arrow = lateral plate mesoderm. (C) arrowhead = notochordal plate. (F) arrow = neuroectoderm. (G) arrow = neuroectoderm.
Expression Pattern Description
Spatial Annotation:
EMAGE:3270EMAGE:3270EMAGE:3270EMAGE:3270Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mapping3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3270_voxel_notDetected_3D_1.wlz
3270_voxel_strong_3D_1.wlz
3270_voxel_notDetected_3D_2.wlz
3270_voxel_strong_3D_2.wlz
3270_voxel_notDetected_3D_3.wlz
3270_voxel_strong_3D_3.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3270_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
node
detected detected
regionalCryptic staining is restricted to the ventral mesoderm layer of the node, and is not observed in the overlying dorsal layer that is continuous with the epiblast.
neural ectoderm
detected detected
regionalIn sections that are immediately rostral to the node, staining is found in the notochordal plate and in a narrow patch of the adjacent midline neuroectoderm.
notochordal plate
detected detected
regionalIn sections that are immediately rostral to the node, staining is found in the notochordal plate and in a narrow patch of the adjacent midline neuroectoderm. (FigC,F) In frontal sections through more rostral regions of the notochordal plate, this midline neuroectoderm staining becomes slightly broader in extent (Fig D,G)
embryo mesoderm
detected detected
regionalCryptic staining is restricted to the ventral mesoderm layer of the node, and is not observed in the overlying dorsal layer that is continuous with the epiblast. Arrow indicates expression in lateral plate mesoderm
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1334279
Entity Detected:Cfc1, cripto, FRL-1, cryptic family 1 ( MGI:109448)
Sequence:sense strand is shown

>MGI:1334279
CAGGACTGTATAGGGTCAGCACTTCCAGCCTGGTGGTTCAGAGCTCCTGACCTGAGAGGGCTTCAACACC
TGGACTCCAGGATCTTCCTTTAACCCTGCTGTCTCTGGTCCAGGCAGAGGGCAGAGACATCTTCATCTTG
CAAGACTGTGCATCCTGTAACCTGCTATAGTGATTCCAAGACCTGGAGTAAAGGGTGCCTCCGGGGCTAG
GATATTTGAGTTTCAACTTCTGTGGTCATCGATCCCCAAGCACAGATGAGAGCGAACTCACCAACCCAGG
GTATCAGTTTGAAAATGCATCAAGCCAGGCCTCTGTTTTTGGTGACTGTCGCGCTGCAGCTCATCGGTCT
GGGATACAGTTATCAGAGCGAAGGAGATGGTGCCAGAGAAGTCAGCAATATCCTCTCTCCAGTGATCCCC
GGGACGACACTGGACAGAACTCTGAGTAATTCCAGCAGAAAGAATGACATTCCGGAGGGGGCGCGCCTAT
GGGATTCCCTTCCTGACTCCAGCACTTTGGGAGAGAGTGCAGTCCCTGTATCCCGCTGTTGCCACAATGG
CGGCACCTGTGTTCTGGGCAGTTTCTGCGTGTGCCCTGCCTATTTCACTGGTCGCTATTGCGAGCACGAC
CAGAGGCGCAGAGACTGTGGTGCCCTAGGGCATGGAGCTTGGACCCTGCACAGCTGCCGCCTATGCAGGT
GCATCTTCTCAGCCCTGTACTGCCTCCCACACCAAACGTTCAGCCACTGTGACCTGAAAAGCTTCCTTTC
TTCAGGCGCCAGAGGATCAAGAGAATGCAGCATCCCAAGCCTCCTCCTGCTGGTGCTCTGCCTCCTCCTG
CAGGGTGTGGCTGGTAAGGGCTGAGGCTCCTAAGTGCGATGATAGACTCTCCTCCTGAGCTGTCACCCTT
GATTACACCACAGTGTGCCAGCAAGAAAGCTGGGTGGTGGGCATCTGACTTGGTGTTGTGTCCTGTAAAT
AACAGATTCACTGGAATATGCTGGATTCTCATGCTGTACAATAAAGAGGCTTAATGGTG
nt 1 - nt 1039 of U57720.1
Notes:The Cfc1 (cryptic) probe used is this study by Shen et al, 1997 [PMID:9053319] is described as the "entire cDNA". The cryptic cDNA sequence U57720.1 includes both UTRs and ORF sequence and was a direct submission to GenBank from Michael Shen.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:Swiss Webster
Age:early headfold Downs & Davies
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
Staining procedure:alkaline phosphatase + NBT/BCIP in 10%PVA
General Information
Authors:Shen MM, Wang H, Leder P (1997) [PMID:9053319] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9053319] Shen MM, Wang H, Leder P 1997 A differential display strategy identifies Cryptic, a novel EGF-related gene expressed in the axial and lateral mesoderm during mouse gastrulation. Development (124):429-42
 [ PMID:8269852] Downs KM, Davies T 1993 Staging of gastrulating mouse embryos by morphological landmarks in the dissecting microscope. Development (118):1255-66
Links:MGI:1334280 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI