Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3289

Bmp6 bone morphogenetic protein 6 ( MGI:88182)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:3289 EMAGE:3289
Figure 5D of Jones etal., 1991 [PMID:1893873] . Copyright: This image is from Jones et al., Development 111:531-542 (1991), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 5C of Jones etal., 1991 [PMID:1893873] . Copyright: This image is from Jones et al., Development 111:531-542 (1991), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image annotations: IV, fourth ventricle; rp, roof of IV ventricle.
Expression Pattern Description
Spatial Annotation:
EMAGE:3289EMAGE:3289Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3289_voxel_strong_3D_1.wlz
3289_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3289_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
neural tube roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
midbrain roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
rhombomere 08 roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
rhombomere 07 roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
rhombomere 06 roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
rhombomere 05 roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
rhombomere 04 roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
rhombomere 03 roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
rhombomere 02 roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
rhombomere 01 roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
diencephalon roof plate
detected detected
regionalThe anterior limit of expression in the roof plate extends midway through the forebrain.
Annotation Validation: Submitter + EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:9001
Entity Detected:Bmp6, bone morphogenetic protein 6 ( MGI:88182)
Sequence:sense strand is shown

>MGI:9001
GACGGCCCGCGAGGAGCCCCCTCCAGGGCGGCTGAAGTCCGCTCCACTCTTCATGCTGGATCTCTACAAC
GCCCTGTCCAATGACGACGAAGAGGATGGGGCATCGGAGGGTGTGGGGCAAGAGCCTGGGTCCCACGGAG
GGGCCAGCTCGTCCCAGCTCAGGCAGCCGTCTCCCGGCGCTGCACACTCCTTGAACCGCAAGAGTCTCCT
GGCCCCGGGACCCGGTGGCGGTGCGTCCCCACTGACTAGCGCGCAGGACAGCGCTTTCCTCAACGACGCG
GACATGGTCATGAGCTTTGTGAACCTGGTGGAGTACGACAAGGAGTTCTCCCCACATCAACGACACCACA
AAGAGTTCAAGTTCAACCTATCCCAGATTCCTGAGGGTGAGGCGGTGACGGCTGCTGAGTTCCGCGTCTA
CAAGGACTGTGTGGTGGGGAGTTTTAAAAACCAAACCTTTCTTATCAGCATTTACCAAGTCTTGCAGGAG
CATCAGCACAGAGACTCTGACCTATTTTTGTTGGACACCCGGGTGGTGTGGGCCTCAGAAGAAGGTTGGC
TGGAATTTGACATCACAGCAACTAGCAATCTGTGGGTGGTGACACCGCAGCACAACATGGGGCTCCAGCT
GAGTGTGGTGACTCGGGATGGACTCCACGTCAACCCCCGTGCGGCGGGCCTGGTGGGCAGAGACGGCCCT
TACGACAAGCAGCCCTTCATGGTGGCCTTCTTCAAGGTGAGCGAGGTCCACGTGCGCACCACCAGGTCAG
CCTCCAGTCGGCGGCGGCAGCAGAGTCGCAACCGGTCCACCCAGTCGCAGGACGTGTCCCGGGGCTCCGG
TTCTTCAGACTACAACGGCAGTGAGTTAAAAACAGCTTGCAAGAAGCATGAGCT
nt 564 - nt 1457 of NM_007556.1
Notes:The Bmp6 (Vgr1) probe used in this study by Jones et al., 1991 [PMID:1893873] )" is indicated as that used by Lyons et al., 1989 [PMID:2481605] who describe "an 893-bp SacI-EcoRI fragment from the 5' region of the Vgr-1 cDNA (Lyons et al., 1989 [PMID:2734307] )." As restriction analysis of Bmp6/Vgr1 clones in the public databases (eg NM_007556.1) finds an internal SacI cut site, but no 5' EcoRI site, this 5' EcoRI site is presumably linker derived. The fragment shown above extends 5' from the SacI site at nt1457 for 893nt.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:(ICR x Swiss Webster)F1
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Jones CM; Lyons KM; Hogan BL, 1991 [PMID:1893873] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:1893873] Jones CM, Lyons KM, Hogan BL 1991 Involvement of Bone Morphogenetic Protein-4 (BMP-4) and Vgr-1 in morphogenesis and neurogenesis in the mouse. Development (111):531-42
 [ doi:10.1101/gad.3.11.1657] [ PMID:2481605] Lyons KM, Pelton RW, Hogan BL 1989 Patterns of expression of murine Vgr-1 and BMP-2a RNA suggest that transforming growth factor-beta-like genes coordinately regulate aspects of embryonic developm Genes Dev (3):1657-68
 [ doi:10.1073/pnas.86.12.4554] [ PMID:2734307] Lyons K, Graycar JL, Lee A, Hashmi S, Lindquist PB, Chen EY, Hogan BL, Derynck R 1989 Vgr-1, a mammalian gene related to Xenopus Vg-1, is a member of the transforming growth factor beta gene superfamily. Proc Natl Acad Sci U S A (86):4554-8
Links:MGI:1276502 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI