Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3300

En1 engrailed 1 ( MGI:95389)
TS12 (8 dpc)
in situ hybridisation

Data Images
EMAGE:3300
Figure 4G of Suda et al., 2001 [PMID:11493561] . Copyright: This image is from Suda et al., Development 128: 2433-2450 (2001), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: asterisk, optic cup.
Expression Pattern Description
Spatial Annotation:
EMAGE:3300Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3300_wholemount_strong_3D_1.wlz
3300_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3300_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future midbrain
detected detected
regionalAuthors report complete regression to the caudal portion of the prospective mesencephalon.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1328386
Entity Detected:En1, engrailed 1 ( MGI:95389)
Sequence:sense strand is shown

>MGI:1328386
CGATCGCTATGGAGGGAGGCATCAATCAGGGCGACAGAGAAAGCGAGCAAGAGAAAGCAATCCTCCGAGT
GGACATTCACATAGGAACAAAACGGTTTTTAAACGGGAGTAAGACTCGGACAGGACAGGTGCTATGGGGG
AAAAATAAACATCTATTCTCTAACTCACTGTATAAGATGAAACTGCG
nt 1649 - nt 1835 of NM_010133.1
Notes:The probe used in this study by Suda et al., 1999 [PMID:9895322] was originally described in Davis & Joyner, 1988 [PMID:2907320] as a "180-bp Sau3A-EcoRI fragment of 3' untranslated DNA".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:8 dpc
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Suda Y; Hossain ZM; Kobayashi C; Hatano O; Yoshida M; Matsuo I; Aizawa S, 2001 [PMID:11493561] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11493561] Suda Y, Hossain ZM, Kobayashi C, Hatano O, Yoshida M, Matsuo I, Aizawa S 2001 Emx2 directs the development of diencephalon in cooperation with Otx2. Development (128):2433-50
 [ doi:10.1101/gad.2.12b.1736] [ PMID:2907320] Davis CA, Joyner AL 1988 Expression patterns of the homeo box-containing genes En-1 and En-2 and the proto-oncogene int-1 diverge during mouse development. Genes Dev (2):1736-44
Links:MGI:2148288 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI