Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3335

Crabp1 cellular retinoic acid binding protein I ( MGI:88490)
TS12 (8.0 dpc)
in situ hybridisation

Data Images
EMAGE:3335
Fig 1A, Leonard et al, 1995 [PMID:7729586] .Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1995.1099] Dev Biol 168: 514-28, Leonard L; Horton C; Maden M; Pizzey JA, Anteriorization of CRABP-I expression by retinoic acid in the developing mouse central nervous system and its relationship to teratogenesis. Copyright 1995

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: POS - preotic sulcus; bar - expression domain of Crabp1 in rhombomeres 4,5,6.
Expression Pattern Description
Spatial Annotation:
EMAGE:3335Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3335_wholemount_strong_3D_1.wlz
3335_wholemount_possible_3D_1.wlz
3335_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3335_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
neural ectoderm
detected detected
regionalExpression is in the neuroepithelium caudal to the preotic sulcus. Based on comparison to Egr2 (Krox20) expression, Crabp1 is expressed in future rhombomere 4.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1340307
Entity Detected:Crabp1, cellular retinoic acid binding protein I ( MGI:88490)
Sequence:sense strand is shown

>MGI:1340307
AACGCAGCGTGCGACCCGTCCGCAGCAGAGGTGGGTGCCTGCCCCTGCCTTCGCGCCGCCGCTACAGCCA
ACACCA
nt 11 - nt 86 of NM_013496.1
Notes:The Crabp1 probe used in this study by Leonard et al., 1995 [PMID:7729586] was produced using "oligonucleotides designed and synthesized to the 5' end of the murine CRABP-1 gene using published sequence data (Wei et al., 1990 [PMID:2171550] ). The forward and reverse primers used were 5'-AACGCAGCGTGCGACCGCTC-3' and 5'-TGGTGTTGGCTGTAGCGGCG-3'. The amplified 76-bp fragment was cloned into pBlue-script KS plasmid."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:involves: Swiss * TO
Age:8.0 dpc
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase
General Information
Authors:Leonard L, Horton C, Maden M, Pizzey JA, 1995 [PMID:7729586] . Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.1995.1099] [ PMID:7729586] Leonard L, Horton C, Maden M, Pizzey JA 1995 Anteriorization of CRABP-I expression by retinoic acid in the developing mouse central nervous system and its relationship to teratogenesis. Dev Biol (168):514-28
 [ doi:10.1089/dna.1990.9.471] [ PMID:2171550] Wei LN, Tsao JL, Chu YS, Jeannotte L, Nguyen-Huu MC 1990 Molecular cloning and transcriptional mapping of the mouse cellular retinoic acid-binding protein gene. DNA Cell Biol (9):471-8
Links:MGI:1340377 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI