Type: | in situ hybridisation probe |
Identifier: | MGI:31029 |
Entity Detected: | Hesx1, homeobox gene expressed in ES cells ( MGI:96071) |
Sequence: | sense strand is shown
>MGI:31029
TGAACTGCTACCCTGGCATTGACATCAGAGAGGACCTAGCTCAAAAGCTAAACTTAGAGGAAGACAGAAT
CCAGATTTGGTTCCAAAATCGCCGAGCAAAGATGAAAAGGTCCCGTAGAGAATCACAGTTTCTAATGGCG
AAAAAACCCTTCAACCCAGATCTTCTGAAATAGGTAGAAAATTACACATGTTGGCTTCTCTTCCAGTTGT
ATAGTACAGAAGAAATCAATGGAAATTCCAAGTACTTAAAATGTTACAGTTCTCTCCTGTATCTAATCTA
GATTTTGTCATTCTTTCTGAAAATACTGCAAATAATTATGGTTCTAGAACAGTACATTTTTAGTTATAAT
TAAAACATCTTTCCTATATATTTTTAATAAAAAAATTTTCAGAAAAAAAAA
|
| nt 742 - nt 1142 of U40720.1 |
Notes: | The Hesx1 (Rpx) probe used in this study by Hermesz et al., 1996 [PMID:8565852] was synthesised from clone pPrd3. The insert of pPrd3 was "isolated by PCR from a (7.5 day p.c. mouse embryo cDNA) library (kindly provided by J. Rossant) using a non-degenerate oligo homologous to a region from the homeobox in combination with a primer specific for the lambda gt10 phage. It contains 400 bp of sequence from the 3' end of the gene extending from the middle of the homeobox to the putative poly(A) tail".
Editor's note: U40720.1 is the sequence submitted to GenBank from Hermesz et al (it is also shown in Fig 1 of their paper) and the sequence start and end co-ordinates above were deduced from the given information. |
Chemistry: | RNA |
Strand: | antisense |
Label: | S35 |