EMAGE mouse gene expression spatial database

EMAGE:3339

Hesx1 homeobox gene expressed in ES cells ( MGI:96071)
TS11 (7.5 dpc)
in situ hybridisation

Data Images


Figure 5F of Hermesz et al., 1996 [PMID:8565852] . Copyright: This image is from Hermesz E, Development 1996 Jan;122(1):41-52, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.	Figure 5E of Hermesz et al., 1996 [PMID:8565852] . Copyright: This image is from Hermesz E, Development 1996 Jan;122(1):41-52, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity:
Find spatially similar expression patterns:

Notes:

Image annotations: ps= primitive streak, en= endoderm/mesendoderm, m= mesoderm, A= anterior and P= posterior. Bar=150um.

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

3D mapping

spatial mapping

View mapped 3D expression image

Download individual expression domains:

Download all expression domains:

Find spatially similar expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

neural ectoderm

detected

regional

Expression is in the prechordal plate that will become the cephalic neural plate

Annotation Validation:

EMAGE Editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	MGI:31029
Entity Detected:	Hesx1, homeobox gene expressed in ES cells ( MGI:96071)
Sequence:	sense strand is shown >MGI:31029 TGAACTGCTACCCTGGCATTGACATCAGAGAGGACCTAGCTCAAAAGCTAAACTTAGAGGAAGACAGAAT CCAGATTTGGTTCCAAAATCGCCGAGCAAAGATGAAAAGGTCCCGTAGAGAATCACAGTTTCTAATGGCG AAAAAACCCTTCAACCCAGATCTTCTGAAATAGGTAGAAAATTACACATGTTGGCTTCTCTTCCAGTTGT ATAGTACAGAAGAAATCAATGGAAATTCCAAGTACTTAAAATGTTACAGTTCTCTCCTGTATCTAATCTA GATTTTGTCATTCTTTCTGAAAATACTGCAAATAATTATGGTTCTAGAACAGTACATTTTTAGTTATAAT TAAAACATCTTTCCTATATATTTTTAATAAAAAAATTTTCAGAAAAAAAAA
	nt 742 - nt 1142 of U40720.1
Notes:	The Hesx1 (Rpx) probe used in this study by Hermesz et al., 1996 [PMID:8565852] was synthesised from clone pPrd3. The insert of pPrd3 was "isolated by PCR from a (7.5 day p.c. mouse embryo cDNA) library (kindly provided by J. Rossant) using a non-degenerate oligo homologous to a region from the homeobox in combination with a primer specific for the lambda gt10 phage. It contains 400 bp of sequence from the 3' end of the gene extending from the middle of the homeobox to the putative poly(A) tail". Editor's note: U40720.1 is the sequence submitted to GenBank from Hermesz et al (it is also shown in Fig 1 of their paper) and the sequence start and end co-ordinates above were deduced from the given information.
Chemistry:	RNA
Strand:	antisense
Label:	S35

Specimen

Procedures

Staining procedure:

autoradiography

General Information

Authors:	Hermesz E; Mackem S; Mahon KA, 1996 [PMID:8565852] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	non-screen
References:	[ doi:10.1006/excr.1993.1044] [ PMID:8440332] Lardelli M, Lendahl U 1993 Motch A and Motch B - two mouse Notch homologues coexpressed in a wide variety of tissues. Exp Cell Res (204):364-72
Links:	MGI:1333970 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source