Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3343

Hhex hematopoietically expressed homeobox ( MGI:96086)
TS09 (6.5 dpc)
in situ hybridisation

Data Images
EMAGE:3343 EMAGE:3343
Figure 1B of Perea-Gomez et al., 2001 [PMID:11171400] . Copyright: This image is from Perea-Gomez A, Development 2001;128():753-765, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 1A of Perea-Gomez et al., 2001 [PMID:11171400] . Copyright: This image is from Perea-Gomez A, Development 2001;128():753-765, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: Scale bar, 100 mm. Anterior is towards the left.
Expression Pattern Description
Spatial Annotation:
EMAGE:3343EMAGE:3343Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3343_voxel_strong_3D_1.wlz
3343_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3343_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
primitive endoderm
detected detected
regionalExpression is detected in the anterior visceral endoderm.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1196513
Entity Detected:Hhex, hematopoietically expressed homeobox ( MGI:96086)
Sequence:sense strand is shown

>MGI:1196513
CGGAGGCCCTCTGTACCCGTTCCCGCGGACGGTGAACGACTACACGCACGCCCTACTCCGCCACGACCCC
CTGGGCAAGCCCTTGCTCTGGAGCCCCTTCCTCCAGCGACCTCTGCACAAAAGGAAAGGCGGTCAAGTGA
GGTTCTCCAACGACCAGACCGTCGAGCTGGAGAAGAAGTTCGAGACTCAGAAATACCTCTCCCCACCCGA
GAGAAAGCGTCTGGCCAAGATGTTGCAGCTCAGTGAGAGACAGGTCAAAACCTGGTTTCAGAATCGCCGA
GCTAAATGGAGAAGACTGAAACAGGAGAATCCTCAAAGCAACAAAAAGGATGCGTTGGACAGTTTGGACA
CTTCCTGTGAGCAGGGTCAAGACTTGCCCAGTGAACAGAATAAAGGTGCCTCTTTGGATCGTTCGCAGTG
TTCACCCTCCCCAGCCTCTCAGGAAGACCCCGACTCGGAGATCTCAGAGGATTCCGACCAGGAGGTGGAC
ATCGAGGGGGATAAAGGCTACTTTAATGCTGGATGACA
nt 291 - nt 818 of Z21524.1
Notes:The Hhex probe used in this study by Perea-Gomez et al., 2001 [PMID:11171400] was originally described in Thomas et al., 1998 [PMID:9389666] who describe the probe as spanning "positions 291-818 of the Hex cDNA sequence (EMBL accession no. Z21524)."
Chemistry:RNA
Strand:antisense
Label:unspecified radioactivity
Specimen
Organism:mouse
Age:6.5 dpc
Theiler Stage:TS09
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
Staining procedure:autoradiography
General Information
Authors:Perea-Gomez A; Lawson KA; Rhinn M; Zakin L; Brulet P; Mazan S; Ang SL, 2001 [PMID:11171400] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11171400] Perea-Gomez A, Lawson KA, Rhinn M, Zakin L, Brulet P, Mazan S, Ang SL 2001 Otx2 is required for visceral endoderm movement and for the restriction of posterior signals in the epiblast of the mouse embryo. Development (128):753-65
 [ PMID:9389666] Thomas PQ, Brown A, Beddington RS 1998 Hex: a homeobox gene revealing peri-implantation asymmetry in the mouse embryo and an early transient marker of endothelial cell precursors. Development (125):85-94
Links:MGI:1930274 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI