Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3388

Tbx1 T-box 1 ( MGI:98493)
TS16 (10 dpc)
in situ hybridisation

Data Images
EMAGE:3388 EMAGE:3388 EMAGE:3388 EMAGE:3388 EMAGE:3388
Figure S1A of Raft et al., 2004 [PMID:15084464] . Copyright: This image is from Raft S, Development 2004;131():1801-1812 and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure S1B of Raft et al., 2004 [PMID:15084464] . Copyright: This image is from Raft S, Development 2004;131():1801-1812 and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure S1C of Raft et al., 2004 [PMID:15084464] . Copyright: This image is from Raft S, Development 2004;131():1801-1812 and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure S1D of Raft et al., 2004 [PMID:15084464] . Copyright: This image is from Raft S, Development 2004;131():1801-1812 and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure S1E of Raft et al., 2004 [PMID:15084464] . Copyright: This image is from Raft S, Development 2004;131():1801-1812 and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: Arrowheads mark the ventral or medial border of expression and the black arrows indiacte the delaminated neural progenitors apposed to the non-expressing epithelium.
Expression Pattern Description
Spatial Annotation:
EMAGE:3388EMAGE:3388EMAGE:3388EMAGE:3388EMAGE:3388Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mapping3D mapping3D mapping3D mapping
EMAGE:3388
spatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3388_voxel_possible_3D_1.wlz
3388_voxel_notDetected_3D_1.wlz
3388_voxel_possible_3D_2.wlz
3388_voxel_notDetected_3D_2.wlz
3388_voxel_strong_3D_1.wlz
3388_voxel_possible_3D_3.wlz
3388_voxel_notDetected_3D_3.wlz
3388_voxel_strong_3D_2.wlz
3388_voxel_possible_3D_4.wlz
3388_voxel_notDetected_3D_4.wlz
3388_voxel_strong_3D_3.wlz
3388_voxel_possible_3D_5.wlz
3388_voxel_notDetected_3D_5.wlz
3388_voxel_strong_3D_4.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3388_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
otocyst epithelium
detected detected
regionalFigure S1A: Absent Figure S1B-S1E: Signal is absent dorsomedially.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3040965
Entity Detected:Tbx1, T-box 1 ( MGI:98493)
Notes:The Tbx1 probe used in this study by Raft et al., 2004 [PMID:15084464] is that originally described by Funke et al., 2001 [PMID:11709542] as "a 461 bp fragment...amplified using primers Tbx1.muRT_R1-F (GGGGGAATTCAGCGAGATCCTGCTACACCT) and Tbx1.muRT_R1-R (GGGGGAATTCCCGAGAGCGAGCAAAGGCA)". Editor's note: Pairwise BLASTing these primer sequences against Tbx1 RefSeq (NM_011532.1) yeilds no similarity hits.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:involves: 129/Sv * C57BL/6J * FVB * SJL
Age:10 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
General Information
Authors:Raft S; Nowotschin S; Liao J; Morrow BE, 2004 [PMID:15084464] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1242/dev.01067] [ PMID:15084464] Raft S, Nowotschin S, Liao J, Morrow BE 2004 Suppression of neural fate and control of inner ear morphogenesis by Tbx1. Development (131):1801-12
 [ doi:10.1093/hmg/10.22.2549] [ PMID:11709542] Funke B, Epstein JA, Kochilas LK, Lu MM, Pandita RK, Liao J, Bauerndistel R, Schuler T, Schorle H, Brown MC, Adams J, Morrow BE 2001 Mice overexpressing genes from the 22q11 region deleted in velo-cardio-facial syndrome/DiGeorge syndrome have middle and inner ear defects. Hum Mol Genet (10):2549-56
Links:MGI:3044703 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI