Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3398

Fgf8 fibroblast growth factor 8 ( MGI:99604)
TS16 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3398
Figure 2D of Copyright: This image is from Rallis et al., Development 130:2741-2751 (2003), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: FL, forelimb (arrowed); HL, hindlimb.
Expression Pattern Description
Spatial Annotation:
EMAGE:3398Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3398_wholemount_strong_3D_1.wlz
3398_wholemount_moderate_3D_1.wlz
3398_wholemount_weak_3D_1.wlz
3398_wholemount_possible_3D_1.wlz
3398_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3398_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb bud apical ectodermal ridge
detected detected
Expression in the apical ectodermal ridge (AER) of the forelimb and hindlimb.
hindlimb bud ectoderm
detected detected
regionalExpression in the apical ectodermal ridge (AER) of the forelimb and hindlimb.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1334951
Entity Detected:Fgf8, fibroblast growth factor 8 ( MGI:99604)
Sequence:sense strand is shown

>MGI:1334951
AGAACGCCAAGTACGAGGGCTGGTACATGGCCTTTACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGAC
GCGCCAGCATCAGCGCGAGGTGCACTTCATGAAGCGCCTGCCGCGGGGCCACCACACCACCGAGCAGAGC
CTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCCAGAGGACTTGGGCCC
CGGAGCCCCGATAGGCGCTCGCCCAGCTCCTCCCCACCCAGCCGGCCGAGGAATCCAGCGGGAGCTCGGC
GGCACAGCAAAGGGGAGGGGCTGGGGAGCTGCCTTCTAGTTGTGCATATTGTTTGCTGTTGGGTTTTTTT
GTTTTTTGTTTTTTGTTTTTGTTTTTTGTTTTTTAAACAAAAGAGAGGCG
nt 598 - nt 997 of D12482.1
Notes:The Fgf8 probe used in this study by Rallis et al., 2003 [PMID:12736217] was originally described in Crossley & Martin, 1995 [PMID:7768185] as a "400nt cDNA probe containing the 3'UTR and C-terminal coding sequences up to the PstI site at nt position 598 in AIGF (Tanaka et al, 1992 [PMID:1409588] )".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Rallis C; Bruneau BG; Del Buono J; Seidman CE; Seidman JG; Nissim S; Tabin CJ; Logan MP, 2003 [PMID:12736217] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1242/dev.00473] [ PMID:12736217] Rallis C, Bruneau BG, Del Buono J, Seidman CE, Seidman JG, Nissim S, Tabin CJ, Logan MP 2003 Tbx5 is required for forelimb bud formation and continued outgrowth. Development (130):2741-51
 [ PMID:7768185] Crossley PH, Martin GR 1995 The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development (121):439-51
 [ doi:10.1073/pnas.89.19.8928] [ PMID:1409588] Tanaka A, Miyamoto K, Minamino N, Takeda M, Sato B, Matsuo H, Matsumoto K 1992 Cloning and characterization of an androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc Natl Acad Sci U S A (89):8928-32
Links:MGI:2677740 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI