Data Images |
|
|
|
|
|
Figure 8B of Shen et al., 1997
[PMID:9053319] .Copyright: This image is from Shen et al.,
Development 124:429-442 (1997), and is displayed with the permission of
The Company of Biologists Limited who owns the Copyright. |
Figure 8C of Shen et al., 1997
[PMID:9053319] .Copyright: This image is from Shen et al.,
Development 124:429-442 (1997), and is displayed with the permission of
The Company of Biologists Limited who owns the Copyright. |
Figure 8D of Shen et al., 1997
[PMID:9053319] .Copyright: This image is from Shen et al.,
Development 124:429-442 (1997), and is displayed with the permission of
The Company of Biologists Limited who owns the Copyright. |
Figure 8E of Shen et al., 1997
[PMID:9053319] .Copyright: This image is from Shen et al.,
Development 124:429-442 (1997), and is displayed with the permission of
The Company of Biologists Limited who owns the Copyright. |
Figure 8F of Shen et al., 1997
[PMID:9053319] .Copyright: This image is from Shen et al.,
Development 124:429-442 (1997), and is displayed with the permission of
The Company of Biologists Limited who owns the Copyright. |
|
|
Expression pattern clarity: |
|
Find spatially similar wholemount expression patterns: |
|
|
|
Notes: |
|
All of these embryos are Theiler Stage 11 and are stained for Cfc1 expression. They range in Downs & Davies stages from LS (late-streak_ to LHF (Late head fold). The spatial annotation in this entry is based on the RHS embryo in Fig 8B, which is the best morphological match to the EMAP TS11 model embryo (which is approx early head fold Downs and Davies stage).
Image annotations: (B) lateral vew of three late-streak to early head-fold stage embryos, anterior to the left. arrow, head process. (C) Lateral view of four early- to late-head-fold stage embryos, with the most advanced embryo on the left. Note the progressive narrowing of the lateral staining (arrow) with developmental age. (D) Ventral (bottom) view of late head-fold stage embryo. arrow, node. (E) Rostral view of an early head-fold stage embryo. arrowhead, node; arrow, lateral plate mesoderm. (F) Lateral view of a late head-fold stage embryo, anterior to the left. arrowhead, node; arrow, notochordal plate. Bars, 0.2 mm. |
|
Expression Pattern Description |
Spatial Annotation: |
| | | | | Annotation colour key:
|
strong |
|
moderate |
|
weak |
|
possible |
|
not detected |
|
wholemount mapping | | | | |
Download individual expression domains: |
|
Download all expression domains: |
EMAGE:3444_all_domains.zip |
Find spatially similar wholemount expression patterns: |
|
Morphological match to the template: |
|
|
Text Annotation: |
Structure | Level | Pattern | Notes |
embryo |
|
detected |
| regional | In early and late head-fold stage embryos, Cryptic is expressed in a striking 'Easter egg' pattern. Staining is notably absent from the prechordal plate. Two symmetrical bands of Cryptic expression extend around the embryo. |
node |
|
strong |
| | See Figs 8B, 8C, 8E, 8F. |
notochordal plate |
|
moderate |
| regional | Staining extends anteriorly along the notochordal plate (Figs 8D, 8E, 8F). |
embryo mesoderm |
|
detected |
| regional | Staining is absent from the paraxial mesoderm (Figs 8B, 8D, 8E, 8F). |
notochordal process |
|
detected |
| | See Fig 8B |
|
Annotation Validation: |
EMAGE Editor |
|
Detection Reagent |
Type: | in situ hybridisation probe |
Identifier: | MGI:1334279 |
Entity Detected: | Cfc1, cripto, FRL-1, cryptic family 1 ( MGI:109448) |
Sequence: | sense strand is shown
>MGI:1334279
CAGGACTGTATAGGGTCAGCACTTCCAGCCTGGTGGTTCAGAGCTCCTGACCTGAGAGGGCTTCAACACC
TGGACTCCAGGATCTTCCTTTAACCCTGCTGTCTCTGGTCCAGGCAGAGGGCAGAGACATCTTCATCTTG
CAAGACTGTGCATCCTGTAACCTGCTATAGTGATTCCAAGACCTGGAGTAAAGGGTGCCTCCGGGGCTAG
GATATTTGAGTTTCAACTTCTGTGGTCATCGATCCCCAAGCACAGATGAGAGCGAACTCACCAACCCAGG
GTATCAGTTTGAAAATGCATCAAGCCAGGCCTCTGTTTTTGGTGACTGTCGCGCTGCAGCTCATCGGTCT
GGGATACAGTTATCAGAGCGAAGGAGATGGTGCCAGAGAAGTCAGCAATATCCTCTCTCCAGTGATCCCC
GGGACGACACTGGACAGAACTCTGAGTAATTCCAGCAGAAAGAATGACATTCCGGAGGGGGCGCGCCTAT
GGGATTCCCTTCCTGACTCCAGCACTTTGGGAGAGAGTGCAGTCCCTGTATCCCGCTGTTGCCACAATGG
CGGCACCTGTGTTCTGGGCAGTTTCTGCGTGTGCCCTGCCTATTTCACTGGTCGCTATTGCGAGCACGAC
CAGAGGCGCAGAGACTGTGGTGCCCTAGGGCATGGAGCTTGGACCCTGCACAGCTGCCGCCTATGCAGGT
GCATCTTCTCAGCCCTGTACTGCCTCCCACACCAAACGTTCAGCCACTGTGACCTGAAAAGCTTCCTTTC
TTCAGGCGCCAGAGGATCAAGAGAATGCAGCATCCCAAGCCTCCTCCTGCTGGTGCTCTGCCTCCTCCTG
CAGGGTGTGGCTGGTAAGGGCTGAGGCTCCTAAGTGCGATGATAGACTCTCCTCCTGAGCTGTCACCCTT
GATTACACCACAGTGTGCCAGCAAGAAAGCTGGGTGGTGGGCATCTGACTTGGTGTTGTGTCCTGTAAAT
AACAGATTCACTGGAATATGCTGGATTCTCATGCTGTACAATAAAGAGGCTTAATGGTG
|
| nt 1 - nt 1039 of U57720.1 |
Notes: | The Cfc1 (cryptic) probe used is this study by Shen et al, 1997 [PMID:9053319] is described as the "entire cDNA".
The cryptic cDNA sequence U57720.1 includes both UTRs and ORF sequence and was a direct submission to GenBank from Michael Shen. |
Chemistry: | RNA |
Strand: | antisense |
Label: | digoxigenin |
|
Specimen |
Organism: | mouse |
Strain: | Swiss Webster |
Age: | EHF Downs & Davies |
Theiler Stage: | TS11 |
Mutations: | none (wild-type) |
Preparation: | wholemount |
|
Procedures |
Fixation: | 4% paraformaldehyde |
Staining procedure: | alkaline phosphatase + NBT/BCIP in 10%PVA |
|
General Information |
Authors: | Shen MM; Wang H; Leder P, 1997 [PMID:9053319] .
Indexed by GXD, Spatially mapped by EMAGE. |
Submitted by: | EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU |
Experiment type: | non-screen |
References: | [ PMID:9053319] Shen MM, Wang H, Leder P 1997 A differential display strategy identifies Cryptic, a novel EGF-related gene expressed in the axial and lateral mesoderm during mouse gastrulation. Development (124):429-42 |
Links: | MGI:1334280 same experiment |
| Ensembl same gene |
| Allen Brain Atlas same gene |
| BioGPS same gene |
| International Mouse Knockout Project Status same gene |
| GEISHA Chicken ISH Database same gene |
| EMBL-EBI Gene Expression Atlas same gene |
| BrainStars same gene |
| ViBrism same gene |
Data Source | |
|