Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3444

Cfc1 cripto, FRL-1, cryptic family 1 ( MGI:109448)
TS11 (EHF Downs & Davies)
in situ hybridisation

Data Images
EMAGE:3444 EMAGE:3444 EMAGE:3444 EMAGE:3444 EMAGE:3444
Figure 8B of Shen et al., 1997 [PMID:9053319] .Copyright: This image is from Shen et al., Development 124:429-442 (1997), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 8C of Shen et al., 1997 [PMID:9053319] .Copyright: This image is from Shen et al., Development 124:429-442 (1997), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 8D of Shen et al., 1997 [PMID:9053319] .Copyright: This image is from Shen et al., Development 124:429-442 (1997), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 8E of Shen et al., 1997 [PMID:9053319] .Copyright: This image is from Shen et al., Development 124:429-442 (1997), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 8F of Shen et al., 1997 [PMID:9053319] .Copyright: This image is from Shen et al., Development 124:429-442 (1997), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
All of these embryos are Theiler Stage 11 and are stained for Cfc1 expression. They range in Downs & Davies stages from LS (late-streak_ to LHF (Late head fold). The spatial annotation in this entry is based on the RHS embryo in Fig 8B, which is the best morphological match to the EMAP TS11 model embryo (which is approx early head fold Downs and Davies stage). Image annotations: (B) lateral vew of three late-streak to early head-fold stage embryos, anterior to the left. arrow, head process. (C) Lateral view of four early- to late-head-fold stage embryos, with the most advanced embryo on the left. Note the progressive narrowing of the lateral staining (arrow) with developmental age. (D) Ventral (bottom) view of late head-fold stage embryo. arrow, node. (E) Rostral view of an early head-fold stage embryo. arrowhead, node; arrow, lateral plate mesoderm. (F) Lateral view of a late head-fold stage embryo, anterior to the left. arrowhead, node; arrow, notochordal plate. Bars, 0.2 mm.
Expression Pattern Description
Spatial Annotation:
EMAGE:3444Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3444_wholemount_strong_3D_1.wlz
3444_wholemount_moderate_3D_1.wlz
3444_wholemount_weak_3D_1.wlz
3444_wholemount_possible_3D_1.wlz
3444_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3444_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
regionalIn early and late head-fold stage embryos, Cryptic is expressed in a striking 'Easter egg' pattern. Staining is notably absent from the prechordal plate. Two symmetrical bands of Cryptic expression extend around the embryo.
node
strong strong
See Figs 8B, 8C, 8E, 8F.
notochordal plate
moderate moderate
regionalStaining extends anteriorly along the notochordal plate (Figs 8D, 8E, 8F).
embryo mesoderm
detected detected
regionalStaining is absent from the paraxial mesoderm (Figs 8B, 8D, 8E, 8F).
notochordal process
detected detected
See Fig 8B
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1334279
Entity Detected:Cfc1, cripto, FRL-1, cryptic family 1 ( MGI:109448)
Sequence:sense strand is shown

>MGI:1334279
CAGGACTGTATAGGGTCAGCACTTCCAGCCTGGTGGTTCAGAGCTCCTGACCTGAGAGGGCTTCAACACC
TGGACTCCAGGATCTTCCTTTAACCCTGCTGTCTCTGGTCCAGGCAGAGGGCAGAGACATCTTCATCTTG
CAAGACTGTGCATCCTGTAACCTGCTATAGTGATTCCAAGACCTGGAGTAAAGGGTGCCTCCGGGGCTAG
GATATTTGAGTTTCAACTTCTGTGGTCATCGATCCCCAAGCACAGATGAGAGCGAACTCACCAACCCAGG
GTATCAGTTTGAAAATGCATCAAGCCAGGCCTCTGTTTTTGGTGACTGTCGCGCTGCAGCTCATCGGTCT
GGGATACAGTTATCAGAGCGAAGGAGATGGTGCCAGAGAAGTCAGCAATATCCTCTCTCCAGTGATCCCC
GGGACGACACTGGACAGAACTCTGAGTAATTCCAGCAGAAAGAATGACATTCCGGAGGGGGCGCGCCTAT
GGGATTCCCTTCCTGACTCCAGCACTTTGGGAGAGAGTGCAGTCCCTGTATCCCGCTGTTGCCACAATGG
CGGCACCTGTGTTCTGGGCAGTTTCTGCGTGTGCCCTGCCTATTTCACTGGTCGCTATTGCGAGCACGAC
CAGAGGCGCAGAGACTGTGGTGCCCTAGGGCATGGAGCTTGGACCCTGCACAGCTGCCGCCTATGCAGGT
GCATCTTCTCAGCCCTGTACTGCCTCCCACACCAAACGTTCAGCCACTGTGACCTGAAAAGCTTCCTTTC
TTCAGGCGCCAGAGGATCAAGAGAATGCAGCATCCCAAGCCTCCTCCTGCTGGTGCTCTGCCTCCTCCTG
CAGGGTGTGGCTGGTAAGGGCTGAGGCTCCTAAGTGCGATGATAGACTCTCCTCCTGAGCTGTCACCCTT
GATTACACCACAGTGTGCCAGCAAGAAAGCTGGGTGGTGGGCATCTGACTTGGTGTTGTGTCCTGTAAAT
AACAGATTCACTGGAATATGCTGGATTCTCATGCTGTACAATAAAGAGGCTTAATGGTG
nt 1 - nt 1039 of U57720.1
Notes:The Cfc1 (cryptic) probe used is this study by Shen et al, 1997 [PMID:9053319] is described as the "entire cDNA". The cryptic cDNA sequence U57720.1 includes both UTRs and ORF sequence and was a direct submission to GenBank from Michael Shen.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:Swiss Webster
Age:EHF Downs & Davies
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP in 10%PVA
General Information
Authors:Shen MM; Wang H; Leder P, 1997 [PMID:9053319] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9053319] Shen MM, Wang H, Leder P 1997 A differential display strategy identifies Cryptic, a novel EGF-related gene expressed in the axial and lateral mesoderm during mouse gastrulation. Development (124):429-42
Links:MGI:1334280 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI