Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3450

Fgf15 fibroblast growth factor 15 ( MGI:1096383)
TS16 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3450
Figure 7C of McWhirter et al., 1997 [PMID:9310317] . Copyright: This image is from McWhirter et al., Development 1997 Sep;124(17):3221-32, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: Arrowheads point to the borders between the rhombomeres. mes, mesencephalon; pe, pharangeal endoderm; r1, rhombomere 1; sc, spinal cord; tel, telencephalon.
Expression Pattern Description
Spatial Annotation:
EMAGE:3450Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3450_wholemount_strong_3D_1.wlz
3450_wholemount_moderate_3D_1.wlz
3450_wholemount_possible_3D_1.wlz
3450_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3450_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
1st branchial membrane endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
1st branchial pouch endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
1st branchial arch mandibular component endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
1st branchial arch maxillary component endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
2nd branchial membrane endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
2nd branchial pouch endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
2nd branchial arch endoderm
detected detected
regional
3rd branchial membrane endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
3rd branchial pouch endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
3rd branchial arch endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
4th branchial membrane endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
4th branchial pouch endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
4th branchial arch endoderm
detected detected
regionalExpression in the pharyngeal endoderm.
future hindbrain
detected detected
regionalExpression at the borders between rhombomeres.
diencephalon
detected detected
regionalExpression in the dorsal thalamus with little or no expression in the ventral thalamus or epithalamus.
future midbrain
weak weak
regionalLittle or no expression was seen in the isthmus at the caudal end of the midbrain.
optic cup inner layer
detected detected
rhombomere 01
detected detected
regionalExpression in the dorsal region.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1098157
Entity Detected:Fgf15, fibroblast growth factor 15 ( MGI:1096383)
Sequence:sense strand is shown

>MGI:1098157
CCAGTTGCTTTGTGGGTTGTGCCTGCCCTGCGCCTGCAACTTGAGTCCCCGCCGCATCGCAGTCTCCGCG
CCACCTTTGTAACGGCCTTCAGGACCCCGAGGTGTCATGGCGAGAAAGTGGAACGGGCGTGCGGTGGCCC
GAGCCCTGGTCCTGGCCACTCTGTGGCTGGCTGTGTCTGGGCGTCCCCTGGCCCAGCAATCCCAGTCTGT
GTCAGATGAAGATCCACTCTTTCTCTACGGCTGGGGCAAGATTACCCGCCTGCAGTACCTGTACTCCGCT
GGTCCCTATGTCTCCAACTGCTTCCTCCGAATCCGGAGCGACGGCTCTGTGGACTGCGAGGAGGACCAAA
ACGAACGAAATTTGTTGGAATTCCGCGCGGTCGCTCTGAAGACGATTGCCATCAAGGACGTCAGCAGCGT
GCGGTACCTCTGCATGAGCGCGGACGGCAAGATATACGGGCTGATTCGCTACTCGGAGGAAGACTGTACC
TTCAGGGAGGAAATGGACTGTTTAGGCTACAACCAGTACAGATCCATGAAGCACCATCTCCATATCATCT
TCATCCAGGCCAAGCCCAGAGAACAGCTCCAGGACCAGAAACCCTCAAACTTTATCCCCGTGTTTCACCG
CTCCTTCTTTGAAACCGGGGACCAGCTGAGGTCTAAAATGTTCTCCCTGCCCCTGGAGAGTGACAGCATG
GATCCGTTCAGGATGGTGGAGGATGTAGACCACCTAGTGAAGAGTCCCAGCTTCCAGAAATGACAGGATT
CCGACAGGATGGAGAAAACCCCAAGGTCCCGTGAACT
nt 42 - nt 848 of AF007268.1
Notes:The Fgf15 probe used in this study by McWhirter et al., 1997 [PMID:9310317] was "an 806 bp fragment corresponding to nucleotides 42 to 848 of the FGF-15 cDNA" Editors note: the relevant sequence is shown in Fig3 therein, and the authors give its GenBank Accession number as AF007268.1.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:McWhirter JR; Goulding M; Weiner JA; Chun J; Murre C, 1997 [PMID:9310317] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9310317] McWhirter JR, Goulding M, Weiner JA, Chun J, Murre C 1997 A novel fibroblast growth factor gene expressed in the developing nervous system is a downstream target of the chimeric homeodomain oncoprotein E2A-Pbx1. Development (124):3221-32
Links:MGI:2179068 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI